| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of 1 Cell Biology and Physiology and 2 Internal Medicine, Washington University School of Medicine, St. Louis, MO; and 3 Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO
Requests for reprints: Christine M. Lovly, Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, Box 8228, St. Louis, MO 63110. Phone: (314) 362-6834; Fax: (314) 362-3709. E-mail: lovlyc{at}msnotes.wustl.edu
| Abstract |
|---|
|
|
|---|
Key Words: Chk2 Checkpoints DNA damage Li-Fraumeni syndrome p53
| Introduction |
|---|
|
|
|---|
A number of studies have focused on defining downstream effectors of ATM that are important for propagating the DNA damage signal. In response to IR, functional ATM is required for activation of Chk2 (69). Chk2, the human homologue of the checkpoint kinases Cds1 (Schizosaccharomyces pombe) and Rad53 (Saccharomyces cerevisiae), is a serine/threonine-protein kinase that is phosphorylated and activated in response to IR and to a lesser extent by hydroxyurea treatment. Chk2 kinase activation is required for IR-induced phosphorylation of the p53 tumor suppressor on serine 20. Ectopic expression of wild-type but not catalytically inactive Chk2 leads to enhanced p53 stabilization and G1 arrest after DNA damage in U2OS cells (10). Consistent with these results, cells derived from Chk2-deficient mice demonstrate significant defects in both the IR-induced G1-phase checkpoint and p53-dependent apoptosis (11, 12). Moreover, heterozygous germ line mutations in the Chk2 gene have been associated with a p53-independent variant form of Li-Fraumeni syndrome, a heritable cancer predisposition syndrome characterized by early onset of leukemia and lymphoma, as well as tumors of the breast, brain, and adrenal cortex (13).
While much of the current work on Chk2 has focused on understanding how Chk2 propagates DNA damage signals, less is known about how Chk2 itself is activated in response to DNA damage. Several groups have reported that ATM can directly phosphorylate Chk2 in vitro on threonine 68 (T68) (1417). In vivo, phosphorylation of T68 is IR-inducible and requires ATM. Phosphorylation of T68 has been linked to activation of Chk2 kinase activity after IR because the T68A mutant of Chk2 fails to become fully activated in response to IR. T68 phosphorylation, however, is not the sole requirement for activation of Chk2, as the T68A mutation does not completely abolish IR-induced increases in Chk2 activity (14). More recently, T68 has been proposed to function as a trigger for a cascade of Chk2 phosphorylation events that includes phosphorylation of threonines 383 and 387, two conserved residues located within the activation loop of the Chk2 kinase domain (18).
T68 lies in the SQ/TQ cluster domain of Chk2. Distal to the SQ/TQ cluster domain, Chk2 contains a forkhead-associated (FHA) domain, which may also play a role in Chk2 activation and regulation post IR. FHA domains function as phospho-threonine (pT)-binding protein-protein interaction motifs. Structures of the Chk2 FHA domain and the RAD53 FHA2 domain complexed with bound pT-containing peptides have been solved (1921). Heritable mutations in the FHA domain of Chk2 associated with Li-Fraumeni syndrome occur within ß strands that do not contact bound pT-containing peptides (13, 21). This region has been proposed to contribute binding surfaces for the interactions between Chk2 and its target substrates (21). The FHA domain of Chk2 has also been proposed to mediate Chk2 oligomerization via direct interaction with Chk2 molecules that are phosphorylated on threonine residues, including T68 (2123). However, there are discrepancies regarding the absolute requirement of T68 phosphorylation for oligomerization and regarding the contribution made by Chk2 kinase activity to the stability of Chk2 oligomers.
In this study, the phosphorylation and activation of human Chk2 was examined both in vitro and in vivo. Chk2 was capable of autoactivation when it was overproduced in bacteria or in mammalian tissue culture cells in the absence of IR. Autoactivation was consistent with the phosphorylation of Chk2 on T68, T383/T387, and on S516a novel phosphorylation site identified in this study. Furthermore, autoactivation was coincident with oligomerization of Chk2 molecules in mammalian tissue culture cells. Taken together, these results suggest that oligomerization can promote phosphorylation and autoactivation of Chk2 in the absence of IR and ATM activity.
| Results |
|---|
|
|
|---|
|
phosphatase increased its electrophoretic mobility (Fig. 2B). As seen in panel 2A (left panel), phosphorylation of T68, S516, and T383/T387 occurred in a time-dependent manner being first detected at 30 min post induction. The timing of one phosphorylation site relative to another cannot be assessed due to differences in the affinity between each phospho-specific antibody for its relevant epitope. Kinase-inactive Chk2 was not phosphorylated on T68, S516, or T383/T387 and its electrophoretic mobility did not change with time (Fig. 2A, right panel). Thus, both the phosphorylation and electrophoretic mobility shift of Chk2 required Chk2 kinase activity in this assay. In addition, a correlation between Chk2 phosphorylation and enhanced Chk2 kinase activity was observed demonstrating that phosphorylation positively regulates Chk2 kinase activity (Fig. 2C). The phosphorylation of recombinant Chk2 observed in vitro could be due to either trans-phosphorylation (intermolecular between two Chk2 molecules) or autophosphorylation (intramolecular within a single Chk2 molecule) mechanisms. As seen in Fig. 2E, kinase-active Chk2 phosphorylated kinase-inactive Chk2 on T68 (lane 6), T383/T387 (lane 9), and S516 (lane 12). Thus, phosphorylation of Chk2 on T68, T383/T387, and S516 can occur in trans in the absence of ATM. However, in these reactions, the kinase-inactive substrate was present at higher levels than the wild-type Chk2 enzyme (lane 3). Interestingly, individual sites appear to show some preference for auto- versus trans-phosphorylation. WT Chk2 favored phosphorylation of T383/T387 in trans on the kinase-inactive mutant (lane 9). In contrast, WT Chk2 preferred to autophosphorylate (in cis) on T68 and S516 rather than to trans-phosphorylate the kinase-inactive mutant on these sites (lanes 6 and 12).
|
|
-irradiated were lysed and lysates were incubated with the anti-pS516 antibody. Chk2 protein levels were monitored in the immunoprecipitate (IP) and post-immunoprecipitate supernatant (S) by immunoblotting. As seen in Fig. 3B (lane 3), the anti-pS516 antibody completely cleared Chk2 from the supernatant (compare lanes 3 and 4, anti-Chk2 blot). This indicates that Chk2 becomes stoichiometrically phosphorylated on S516 by 30 min post IR. Reactivity of S516-phosphorylated Chk2 with both the pT68 and pT383/T387 antibodies was also observed. As expected, Chk2 was not immunoprecipitated by the anti-pS516 antibody from mock-irradiated lysates (lanes 1 and 2).
Next, wild-type and mutant forms of Chk2 were expressed in cells to determine which phosphorylation sites required the kinase activity of Chk2 and to determine whether there was an interdependence between individual phosphorylation sites (Fig. 3C). Cells expressing wild-type and mutant forms of Chk2 were mock- or
-irradiated and the phosphorylation status of ectopic Chk2 was monitored as a function of time using phospho-specific antibodies. As seen in Fig. 3C, ectopically expressed Chk2 behaved like endogenous Chk2 (Fig. 3A). A slower migrating form of Chk2 was visible 30 min after exposure of cells to IR (anti-flag blot). The slower electrophoretic forms of Chk2 persisted for the duration of the experiment and overall levels of Chk2 declined over the 2-h time period. Chk2 was inducibly phosphorylated on T68, S516, and T383/T387 at 30 min post IR (lane 2) and the phosphorylation of Chk2 on each site paralleled Chk2 protein levels. Kinase-inactive Chk2 (D368N) was inducibly phosphorylated on T68 and T383/T387 after IR (lane 6). In contrast, kinase-inactive Chk2 did not become phosphorylated on S516 following IR, indicating that phosphorylation of S516, but not T68 or T383/T387, absolutely requires the kinase activity of Chk2. Notably, Chk2-T68A was inducibly phosphorylated on T383/T387 and S516 after IR (lane 10), although the kinetics of phosphorylation was delayed relative to wild type (lane 2). Chk2-S516A was inducibly phosphorylated on T68 and T383/T387 after IR (lane 14) with kinetics similar to wild type. Taken together, these data demonstrate that S516 phosphorylation requires the kinase activity of Chk2. In addition, T68 phosphorylation is not required for phosphorylation of T383/T387 and S516 after IR, although it may accelerate the rate of phosphorylation of these sites. Finally, the abundance of Chk2 was monitored by Western blotting following irradiation (Fig. 3D). Cycloheximide was included to block protein synthesis. Levels of both ectopic and endogenous Chk2 declined in a time-dependent manner following IR (lanes 710). In contrast, levels of ectopic and endogenous Chk2 remained unchanged for up to 3 h in mock-irradiated samples (lanes 25).
Serine 516 Phosphorylation Does Not Regulate the Kinase Activity of Chk2
It has previously been shown that phosphorylation of T383/387 is required for Chk2 kinase activity (18) and that phosphorylation of T68 is required for full activation of Chk2 following IR (1417). To determine the contribution made by S516 phosphorylation to Chk2 kinase activity, we monitored the effect of mutation of serine 516 to alanine on the kinase activity of Chk2 both before and after irradiation (Fig. 4). As seen in Fig. 4A, the electrophoretic mobility of Chk2 S516A (lane 10), like Chk2 WT (lane 1), was retarded in response to IR. In contrast, the electrophoretic mobilities of only a small fraction of Chk2 T68A (lane 8) and of Chk2 T68A/S516A (lane 12) were retarded following IR and the mobilities of Chk2 D368N (lane 4) and of Chk2 T383A/T387A (lane 6) were not altered by IR. The kinase activity of Chk2 was significantly impaired by mutation of T383/T387 (Fig. 4C). In contrast, the kinase activity of Chk2 S516A was not significantly different from that of wild-type Chk2 in either the absence or presence of IR (Fig. 4B). Thus, phosphorylation of Chk2 on S516 following IR does not appear to regulate the kinase activity of Chk2.
|
|
-irradiated. The phosphorylation status of ectopic Chk2 D368N was monitored using phospho-specific antibodies. As seen in Fig. 5D, Chk2 D368N was phosphorylated on T68 in the absence of IR (lane 1) and as expected levels of T68 phosphorylation rose following IR (lane 2). Importantly, Chk2 D368N was not phosphorylated on T383/T387 in Chk2-/- cells, suggesting that the phosphorylation observed following IR in HeLa cells (Fig. 3C, lanes 68) is due to phosphorylation by endogenous Chk2 in trans. Consistent with data shown in Figs. 3C and 5B, Chk2 D368N was not phosphorylated on S516.
Chk2 (I157T) Is Impaired in Its Ability to Oligomerize
Two Chk2 FHA domain mutations have been reported in patients with Li-Fraumeni syndrome (13). One of these mutations (R145W) impairs the kinase activity of Chk2 (18, 21, 26). A second mutant form of Chk2 containing threonine in place of isoleucine at position 157 has normal kinase activity, is phosphorylated on T68 following IR, and its FHA domain binds normally to pThr-containing phosphopeptides (21, 26). To decipher the defect associated with this mutant, we overproduced Chk2 I157T in Chk2-/- MEFs and compared its behavior to wild-type Chk2 (Fig. 6). As shown previously, there is a direct correlation between the Chk2 kinase activity, Chk2 phosphorylation, and mobility shifts on SDS gels (Figs. 2 and 5). Given that the I157T mutant was fully active as a protein kinase, we expected this mutant to undergo autophosphorylation and to migrate more slowly on SDS gels to the same extent as wild-type Chk2. The electrophoretic mobility of Chk2 I157T was retarded when it was overexpressed but the fraction of Chk2 I157T that exhibited this altered mobility was significantly reduced compared with wild-type Chk2 (Fig. 6A, lane 2, lower two panels). Interestingly, mutation of isoleucine 157 severely impaired the ability of Chk2 to associate with other Chk2 molecules (Fig. 6A, lane 2, upper two panels). In addition, Chk2 I157T was not efficiently phosphorylated on T68, T383/T387, or S516 (Fig. 6B, lane 2). Failure of Chk2 I157T to efficiently oligomerize likely accounts for the reduced autophosphorylation observed when it is overproduced in Chk2-/- MEFs. Similar observations were made in 293 cells (data not shown).
|
| Discussion |
|---|
|
|
|---|
Although Chk2 oligomerization is reportedly induced by DNA damage signals in vivo, we observed significant oligomerization of Chk2 in Chk2-/- MEFs and in 293 cells in the absence of IR. This is likely due to the high levels of Chk2 protein produced in these cells. Similarly, we observed autoactivation of Chk2 kinase activity in bacteria in a time- and phosphorylation-dependent manner as the concentration of Chk2 increased. Thus, overexpression of Chk2 promotes auto- and trans-phosphorylation events that in turn result in activation of Chk2 in the absence of IR. We observed significant phosphorylation, oligomerization, and activation of Chk2 kinase activity by simply increasing the concentration of Chk2. Similarly, in budding yeast, increases in local concentration have been proposed to promote Rad53 phosphorylation and activation in response to checkpoints. In this organism, Rad53 local concentration is regulated by binding to the Rad9 scaffolding protein. Phosphorylation of Rad9 by Mec1/Tel1 has been proposed to promote binding of multiple Rad53 molecules via interactions between phosphorylated threonine residues in Rad9 and the FHA domain of Rad53. Bound Rad53 molecules undergo trans-phosphorylation, activation, and are subsequently released from the Rad9 complex to phosphorylate downstream targets. Although a human equivalent to the Rad9 scaffolding protein has not been identified, it is possible that a similar mechanism operates to activate Chk2. In this case, however, a scaffolding protein may not be required. Phosphorylated Chk2 is capable of directly binding an inactive Chk2 molecule via interactions between phosphorylated residues in the amino terminus of activated Chk2 and the FHA domain of the inactive Chk2 molecule. Because Chk2 can oligomerize and autoactivate, it becomes even more important to understand how local Chk2 concentration is regulated before and after IR in vivo.
A subset of patients with Li-Fraumeni syndrome contains mutations in the FHA domain of Chk2 (13). One of these mutations substitutes threonine for isoleucine at position 157. The I157T mutant has normal kinase activity, is phosphorylated on T68 following IR, and its FHA domain binds normally to pThr-containing phosphopeptides (21, 26). Li et al. (21) reported that Chk2 I157T does not bind to target substrates as efficiently as wild-type Chk2. In this study, we demonstrate that the I157T mutant is severely impaired in its ability to oligomerize and as a consequence, to autophosphorylate in vivo. Thus, the FHA domain is a multifunctional domain that contributes binding surfaces for substrate docking and oligomerization, some of which are dependent on pT and others not.
Serine 516 was identified as a novel IR-inducible Chk2 phosphorylation site in vivo. Within 30 min after exposure to IR, Chk2 became stoichiometrically phosphorylated on S516 in vivo (Fig. 3B). Mutation of serine 516 to alanine did not impair the ability of IR to activate the kinase activity of Chk2 (Fig. 4) or to induce a phosphorylation-dependent shift in the electrophoretic mobility of Chk2 (Fig. 3C). Nor did mutation of S516 disrupt the ability of Chk2 to oligomerize in 293 cells (data not shown). Failure to observe oligomerization defects is consistent with models proposed by Ahn et al. (22) and Xu et al. (23) who argue that oligomerization of Chk2 is mediated through FHA-dependent interactions with the phosphorylated amino terminus of Chk2. Thus, it is unclear at this point how serine 516 phosphorylation is regulating Chk2 function. However, the identification of a DNA damage-inducible phosphorylation site in the COOH terminus of Chk2, outside of previously characterized functional domains, suggests that this region may contribute to Chk2 regulation. Interestingly, truncation mutants that lack the COOH-terminal domain but possess an intact kinase domain, are kinase-inactive (data not shown). In addition, this domain may regulate the interactions of Chk2 with regulatory proteins or substrates or perhaps contribute to the localization of Chk2 following checkpoint activation. Further experimentation is required to address these possibilities.
Expression of kinase-inactive Chk2 in cells containing and lacking endogenous Chk2 allowed us to investigate the dependency of various Chk2 phosphorylation sites on Chk2 kinase activity. We found that phosphorylation of kinase-inactive Chk2 on T68 can occur in the absence of IR, in the absence of endogenous Chk2 (Figs. 1F, 3C, and 5, B and D), in the absence of ATM (Fig. 5C), and in the presence of caffeine (data not shown). Thus, kinases in addition to ATM and Chk2 can phosphorylate Chk2 on T68. Recently, PLK1 was reported to phosphorylate Chk2 on T68 (29). In contrast, S516 phosphorylation is absolutely dependent on the kinase activity of Chk2 because kinase-inactive Chk2 was not phosphorylated on S516 following IR, even in cells containing endogenous Chk2 (Figs. 3C and 5D). Phosphorylation of T383/T387 also requires the kinase activity of Chk2 and appears to occur in trans because kinase-inactive Chk2 was not phosphorylated on T383/T387 in cells lacking Chk2 (Fig. 5D) but was phosphorylated on T383/T387 when cells containing Chk2 were irradiated (Fig. 3C).
Our findings together with those of Ahn et al. (22), Xu et al. (23), and others (1517, 22) support a model in which IR activates ATM to phosphorylate Chk2 on T68 (1417). Phosphorylation partially activates the kinase activity of Chk2 and promotes its interactions with a second Chk2 molecule through the FHA domain of the second molecule (22, 23). This in turn promotes the trans-phosphorylation of T383/T387 to activate the second Chk2 molecule which then further activates itself and other Chk2 molecules through cis- and trans-phosphorylation events (see Fig. 7).
|
| Materials and Methods |
|---|
|
|
|---|
Cell Culture and Irradiation
HeLa and 293 cells were routinely maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 100 units/ml penicillin and streptomycin. Chk2 knockout MEFs were routinely maintained in DMEM supplemented with 10% FBS, 100 units/ml penicillin and streptomycin, 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 140 µM 2-mercaptoethanol. AT22IJE-T fibroblasts (cells lacking functional ATM) (25) were cultured in DMEM supplemented with 15% FBS, 2 mM L-glutamine, 100 units/ml penicillin and streptomycin, and 100 µg/ml hygromycin B. In some cases, cells were exposed to 10 Gy from a 60Co source.
Plasmids
pGEX2TN-Chk2 and pET15b-Chk2 have been described previously (30). 3XFlag-Chk2 was generated by digesting pGEX2TN-Chk2 with NdeI and then filling in with Klenow. The Chk2 insert was released from pGEX2TN by digesting with EcoRI. The NdeI/EcoRI Chk2 fragment was ligated into HindIII/EcoRI digested p3XFlag-CMV-10 vector (Sigma). 3XFlag-Chk2(D368N) was generated by site-directed mutagenesis of 3XFlag-Chk2 using the Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the following primers: 5'- GACTGTCTTATAAAGATTACTAATTTTGGGCACTCCAAGATTTTG (forward) and 5'-CAAAATCTTGGAGTGCCCAAAATTAGTAATCTTTATAAGACAGTC (reverse). These primers were also used to generate pET15b-Chk2(D368N) by site-directed mutagenesis of pET15b-Chk2. 3XFlag-Chk2(T68A) was generated by site-directed mutagenesis of 3XFlag-Chk2 and the following primers: 5'-GAGCTCCTTAGAGACAGTGTCCGCTCAGGAACTCTATTCTATTCCTGAG (forward) and 5'-CTCAGGAATAGAATAGAGTTCCTGAGCGGACACTGTCTCTAAGGAGCTC (reverse). 3XFlag-Chk2(S516A) was generated by site-directed mutagenesis of 3XFlag-Chk2 and the following primers: 5'-GTTCTAGCCCAGCCTGCCACTAGTCGAAAGCGG (forward) and 5'-CCGCTTTCGACTAGTGGCAGGCTGGGCTAGAC (reverse). The same primers were used to generate pGEX2TN-Chk2(S516A) by site-directed mutagenesis of pGEX2TN-Chk2 vector. A single Myc tag was added to Chk2 by PCR using the primers: 5'-ATATTAGGTACCATGGCAGAACAGAAGCTCATTTCTGAAGAAGACTTGTCTCGGGAGTCGGATGTTGAGGC (forward) and 5'-ATAGAATTCCTCGAGTCACAACACAGCAGCACACAC (reverse). The PCR product was digested with KpnI and XhoI and inserted into the corresponding sites of pCDNA3 to generate pCDNA3-Myc-Chk2. 3XMyc-Chk2 was generated by adding two additional Myc tags to Myc-Chk2 by PCR using the following primers: 5'-ATATTAGGTACCATGGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGCAGAACAGAAGCTCATTTCTG (forward) and 5'-ATAGAATTCCTCGAGTCACAACACAGCAGCACACAC (reverse). The PCR product was digested with KpnI and XhoI and ligated into the corresponding sites of pCDNA3 to generate 3XMyc-Chk2. 3XMyc-Chk2(S516A) was generated by site-directed mutagenesis of 3XMyc-Chk2 using the S516A primers listed above. 3XFlag-Chk2 (I157T) and Myc-Chk2 (I157T) were generated by site-directed mutagenesis of 3XFlag-Chk2 and Myc-Chk2 using the following primers: 5'-GGTCCTAAAAACTCTTACACTGCATACATAGAAGATCACAGTGGC (forward) and 5'-GCCACTGTGATCTTCTATGTATGCAGTGTAAGAGTTTTTAGGACC (reverse). Sequences of all mutants were verified by DNA sequencing.
Two-Dimensional Phosphopeptide Mapping
293 cells (1.4 x 106) were either mock transfected or transfected with plasmids encoding 3XFlag-tagged wild-type and mutant forms of Chk2 using the Superfect transfection reagent (Qiagen, Valencia, CA). Forty hours post transfection, cells were incubated in phosphate-free DMEM containing 2.5 mCi of 32P-labeled inorganic phosphate per milliliter and 25 µM VP-16 for 2 h. Cells were washed once with ice-cold PBS and lysed in Mammalian Cell Lysis Buffer [MCLB, 50 mM Tris-HCl (pH 8), 150 mM NaCl, 0.5% NP40, 5 mM EDTA, 2 mM DTT, 1 µM microcystin, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 10 µg/ml aprotinin]. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag M2 monoclonal antibody prebound to agarose (Sigma). Immunoprecipitates were subjected to SDS-PAGE on an 8% polyacrylamide gel, and proteins were transferred to nitrocellulose. Radiolabeled Chk2 was digested in a solution containing 1 mg/ml of chymotrypsin (Boehringer Mannheim, Germany) in 50 mM ammonium bicarbonate for 15 h. Chymotryptic phosphopeptides were separated in the first dimension by electrophoresis and in the second dimension by ascending chromatography in a buffer consisting of n-butanol-pyridine-acetic acid-water in a ratio of 75/50/15/60 (31). Endogenous Chk2 was immunoprecipitated from labeled HeLa lysate with affinity-purified polyclonal antibody and protein A-Sepharose beads. To monitor the phosphorylation of recombinant Chk2 in vitro, bacterially produced GST-Chk2 (30) was incubated in incomplete kinase buffer [50 mM Tris-HCl (pH 7.4), 1 mM DTT, 10 mM MgCl2] containing 10 µM ATP and 10 µCi of
-32P-ATP for 30 min at 30°C. The reaction was stopped by the addition of Laemmli buffer and boiling for 10 min. Radiolabeled Chk2 was resolved by SDS-PAGE, digested with chymotrypsin, and analyzed as described above.
Expression, Purification, and Activity of Bacterially Produced Chk2 Protein
E. coli strain BL21 was transformed with pET15b plasmids encoding His6-Chk2 or His6-Chk2(D368N). Cultures were grown at 37°C to an absorbance at 600 nm (A600 nm) of 0.6, and isopropyl-1-thio-D-galactopyranoside (IPTG) was added to a final concentration of 0.5 mM. Ten-milliliter samples of the induced cultures were pelleted at the indicated times and frozen at -80°C. Frozen pellets were resuspended in NP40 lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM EGTA, 0.5% NP40] supplemented with protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 0.15 units/ml of aprotinin, 20 µM leupeptin) and 1 mg/ml lysozyme and rocked at 4°C for 20 min. Cells were lysed by sonication (50% duty cycle for 20 bursts). Lysates were clarified by centrifugation (13,000xg for 15 min). Proteins were precipitated by incubation with Ni2+-NTA agarose (Qiagen) for 1 h at 4°C. Precipitated proteins were washed three times in NP40 lysis buffer and eluted by boiling in 400 µl Laemmli boiling buffer. Twenty microliters of each sample was resolved by SDS-PAGE, and transferred to nitrocellulose followed by Western blotting with mouse monoclonal anti-Chk2 antibody (Neomarkers). To normalize protein amounts/lane, protein was quantified by ECL+ and phosphorimager analysis. Equivalent protein amounts determined by this method were re-run on SDS-PAGE and Western blotted with the indicated antibodies.
His-tagged fusion proteins were precipitated by incubation with Ni2+-NTA agarose (Qiagen) for 1 h at 4°C as described above. Precipitates were washed once with NP40 lysis buffer without detergent, once with LiCl buffer [0.5 M LiCl, 50 mM Tris (pH 8.0)], once with NP40 lysis buffer without detergent, and once with incomplete kinase buffer. Fifty-microliter kinase reactions were carried out in the presence of incomplete kinase buffer containing 10 µM ATP, 10 µCi
-32P-ATP, and 5 µg of soluble GST-Cdc25C(200256) (32). Reaction mixtures were incubated at 30°C for 515 min. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membrane. Radiolabeled proteins were visualized by autoradiography and Ponceau S staining. Incorporated counts were quantified by scintillation counting. Trans-phosphorylation assays of Chk2 were performed by incubating His6-Chk2(D368N) purified from 10 ml induced culture and bound to Ni2+-NTA agarose as described above with 100 ng of soluble GST-Chk2(wt) in the presence of incomplete kinase buffer and 1 mM ATP for 20 min. Reactions were resolved by SDS-PAGE, transferred to nitrocellulose, followed by Western Blotting with the indicated phospho-specific antibodies.
Chk2 Phosphorylation in the Absence and Presence of IR
HeLa cells were transfected with 10 µg 3XFlag-Chk2 (wt or mutants) plus 10 µg pcDNA3 by calcium phosphate transfection according to the manufacturer's guidelines (Life Technologies, Inc., Carlsbad, CA). Forty hours post transfection, cells were either mock-irradiated or irradiated with 10 Gy
-IR. Cells were harvested at 30 min, 1 h, and 2 h post irradiation and lysed in MCLB. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag agarose (Sigma) from 3 mg of total cell lysate. Immunoprecipitates were divided equally into three parts and subjected to SDS-PAGE on 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and Western blotted with phospho-specific antibodies for T68, T383/T387, and S516. Membranes were stripped and re-probed with an antibody against the flag epitope.
For Chk2 knockout MEF studies, 10 µg 3XFlag-Chk2(D368N) were transfected into MEFs using the LipofectAMINE 2000 reagent (Invitrogen, Carlsbad, CA). Forty-eight hours post transfection, cells were either mock- or
-irradiated with 10 Gy IR. Cells were harvested 1 h post IR. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag agarose (Sigma), and immunoprecipitates were subjected to SDS-PAGE on 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and Western blotted with phospho-specific antibodies for T68, T383/T387, and S516. Membranes were stripped and re-probed with an antibody against the flag epitope.
Cycloheximide Experiments
HeLa cells were transfected with 10 µg 3XFlag-Chk2 plus 10 µg pcDNA3 by calcium phosphate transfection according to the manufacturer's guidelines (Life Technologies). Forty hours post transfection, cells were treated with 25 µg/ml cycloheximide for 1 h. Cells were then either mock-irradiated or irradiated with 10 Gy
-IR. Cells were harvested at 30 min, 1 h, 2 h, and 3 h post irradiation and lysed in MCLB. Seventy-five micrograms of total lysate were resolved by SDS-PAGE, transferred to nitrocellulose, and blotted with the Santa Cruz Chk2 monoclonal antibody.
Activation of Chk2 Kinase Activity by IR
HeLa cells were transfected with 10 µg pCDNA3 plasmid plus 10 µg 3XFlag-Chk2 (wt or mutants) by calcium phosphate transfection. Forty hours post transfection, cells were either mock- or
-irradiated with 10 Gy IR. After 30 min of incubation, cells were harvested and lysed in MCLB. Chk2 proteins were immunoprecipitated with flag agarose, washed three times with MCLB and once with incomplete kinase buffer [50 mM Tris-HCl (pH 7.4), 10 mM MgCl2, 1 mM DTT]. Fifty-microliter kinase reactions were carried out in the presence of incomplete kinase buffer containing 10 µM ATP, 10 µCi of
-32P-ATP, and 5 µg of soluble GST-Cdc25C(200256). Reaction mixtures were incubated at 30°C for 10 min and resolved by SDS-PAGE. Incorporated counts were quantified using a phosphorimager (Molecular Biosystems). Error bars represent average counts of triplicate reactions performed for each mutant (Fig. 4B) or duplicate reactions performed for each mutant (Fig. 4C).
Oligomerization of Chk2
Five micrograms of 3XFlag-Chk2 and 5 µg of Myc-Chk2 were cotransfected into 293 cells using the Superfect reagent (Qiagen). Thirty-six hours post transfection, cells were harvested and lysed in MCLB. Lysates were immunoprecipitated with anti-flag (Sigma) and anti-Myc agarose (Santa Cruz Biotechnology). Immunoprecipitates were washed three times in MCLB. Bound proteins were released by boiling in Laemmli boiling buffer, resolved by SDS-PAGE, and visualized by Western blotting with the indicated antibodies.
For I157T oligomerization studies, 5 µg 3XFlag-Chk2(I157T) and 5 µg Myc-Chk2(I157T) or 5 µg 3XFlag-Chk2 and 5 µg Myc-Chk2 were cotransfected into Chk2-/- MEFs using the LipofectAMINE 2000 reagent (Invitrogen). At 33 h post transfection, cells were harvested and lysed in MCLB. Lysates were immunoprecipitated with anti-flag agarose (Sigma) or with anti-Myc agarose (Santa Cruz Biotechnology) for 3 h at 4°C. Immunoprecipitates were subsequently washed three times with MCLB. Bound proteins were released by boiling in Laemmli boiling buffer, resolved by SDS-PAGE, and visualized with the indicated antibodies.
Generation of Recombinant Adenoviruses
Wild-type and kinase inactive forms of Chk2 were cloned as flag-tagged or Myc-tagged fusions into the adenovirus shuttle vector pAdtrack-CMV (33). pcDNA3/CMV-flagChk2 and pcDNA3/CMV-mycChk2 D368N were digested with Kpn1 and Xho1, and the fragments encoding flag-Chk2 or myc-Chk2 D368N were cloned into Kpn1/Xho1 digested pAdtrack-CMV to generate pAdtrack-CMV-flagChk2 and pAdtrack-CMV-mycChk2, respectively. The pAdtrack-CMV-based plasmids encoding Chk2 WT and Chk2 D368N proteins were cotransformed with pAdEasy-1 into E. coli BJ5183 to achieve homologous recombination. Recombinant adenoviruses were generated and propagated using the pAdEasy system as described previously (33).
AT Cell Experiments
AT cells were infected for 60 min with recombinant adenoviruses encoding flag-tagged Chk2 wild-type or myc-tagged Chk2 D368N at a multiplicity of infection of 10 or 5, respectively, in 1 ml of serum-free DMEM. After 1 h, 10 ml of culture medium were added. Twenty-eight hours post infection, cells were harvested and lysed in MCLB. Chk2 proteins were immunoprecipitated with a polyclonal Chk2 antibody and protein A-Sepharose (Pierce, Rockford, IL). Immunoprecipitates were washed four times with MCLB, resolved by SDS-PAGE, and visualized with the indicated antibodies.
| Acknowledgements |
|---|
|
|
|---|
| Notes |
|---|
|
|
|---|
Received February 5, 2003; revised April 16, 2003; accepted April 28, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Li, I. A. Taylor, J. Lloyd, J. A. Clapperton, S. Howell, D. MacMillan, and S. J. Smerdon Chk2 Oligomerization Studied by Phosphopeptide Ligation: IMPLICATIONS FOR REGULATION AND PHOSPHODEPENDENT INTERACTIONS J. Biol. Chem., December 19, 2008; 283(51): 36019 - 36030. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Lovly, L. Yan, C. E. Ryan, S. Takada, and H. Piwnica-Worms Regulation of Chk2 Ubiquitination and Signaling through Autophosphorylation of Serine 379 Mol. Cell. Biol., October 1, 2008; 28(19): 5874 - 5885. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Kass, J. Ahn, T. Tanaka, W. A. Freed-Pastor, S. Keezer, and C. Prives Stability of Checkpoint Kinase 2 Is Regulated via Phosphorylation at Serine 456 J. Biol. Chem., October 12, 2007; 282(41): 30311 - 30321. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Gupta, X. Guo, S. S. Durkin, K. F. Fryrear, M. D. Ward, and O. J. Semmes Human T-cell Leukemia Virus Type 1 Tax Oncoprotein Prevents DNA Damage-induced Chromatin Egress of Hyperphosphorylated Chk2 J. Biol. Chem., October 5, 2007; 282(40): 29431 - 29440. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Rao, C. Conti, J. Guirouilh-Barbat, A. Nakamura, Z.-H. Miao, S. L. Davies, B. Sacca, I. D. Hickson, A. Bensimon, and Y. Pommier Endogenous {gamma}-H2AX-ATM-Chk2 Checkpoint Activation in Bloom's Syndrome Helicase Deficient Cells Is Related to DNA Replication Arrested Forks Mol. Cancer Res., July 1, 2007; 5(7): 713 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rellos, F. J. Ivins, J. E. Baxter, A. Pike, T. J. Nott, D.-M. Parkinson, S. Das, S. Howell, O. Fedorov, Q. Y. Shen, et al. Structure and Regulation of the Human Nek2 Centrosomal Kinase J. Biol. Chem., March 2, 2007; 282(9): 6833 - 6842. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Buscemi, L. Carlessi, L. Zannini, S. Lisanti, E. Fontanella, S. Canevari, and D. Delia DNA Damage-Induced Cell Cycle Regulation and Function of Novel Chk2 Phosphoresidues Mol. Cell. Biol., November 1, 2006; 26(21): 7832 - 7845. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takem |