
Molecular Cancer Research 2:305-314 (2004)
© 2004 American Association for Cancer Research
Signaling and Regulation
HMG-I/Y Is a c-Jun/Activator Protein-1 Target Gene and Is Necessary for c-JunInduced Anchorage-Independent Growth in Rat1a Cells
Fumihiro Hommura1,
Motoo Katabami1,
Virna D. Leaner1,
Howard Donninger1,
Takita F. Sumter2,
Linda M.S. Resar2 and
Michael J. Birrer1
1 Cell and Cancer Biology Branch, National Cancer Institute, Rockville, Maryland and 2 Departments of Pediatrics and Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland
Requests for reprints: Michael J. Birrer, Cell and Cancer Biology Branch, National Cancer Institute, Rockville, MD. Phone: 301-402-9586; Fax: 301-402-4422. E-mail: birrerm{at}bprb.nci.nih.gov
 |
Abstract
|
|---|
The transcription complex activator protein-1 (AP-1) plays a role in a diverse number of cellular processes including proliferation, differentiation, and apoptosis. To identify AP-1responsive target genes, we used a doxycycline-inducible c-Jun system in Rat1a cells. The HMG-I/Y chromatin binding protein was found to be up-regulated by c-Jun. Following induction of c-Jun expression, Rat1a cells under nonadherent growth conditions have sustained HMG-I/Y mRNA expression and 2-fold higher protein than uninduced cells. HMG-I/Y promoter reporter assays show that HMG-I/Y promoter activity increases in the presence of c-Jun expression, and gel mobility shift assays demonstrate that induced c-Jun binds to an AP-1 consensus site at position 1,091 in the HMG-I/Y promoter. Suppression of HMG-I/Y expression by its antisense sequence significantly reduces the ability of c-Junoverexpressing Rat1a cells to grow in an anchorage-independent fashion. HMG-I/Y transforms Rat1a cells (although the colonies are smaller than that observed for the cells overexpressing c-Jun). Taken together, these results suggest that HMG-I/Y is a direct transcriptional target of c-Jun necessary for c-Juninduced anchorage-independent growth in Rat1a cells.
 |
Introduction
|
|---|
c-Jun is a major component of the activator protein-1 (AP-1) transcription factor. It binds to numerous sites, including AP-1 (TGAG[C]TCA) and activating transcription factor (TGACGTCA) sites found in the promoters of a large number of genes. Interaction at these sites occurs as either a homodimer or a heterodimer with members of the Fos family (c-Fos, FosB, Fra1, and Fra2) or activating transcription factor family, thus regulating the expression of genes containing AP-1 binding sites in their promoters. c-Jun plays a critical role in several cellular processes including transformation (1, 2), cell cycle progression (3), differentiation (4), and apoptosis (5). We have previously shown that c-Jun transforms the immortalized rat fibroblast cell line Rat1a as a single gene (6), and overexpression of c-Jun allows the cells to grow in an anchorage-independent manner. Although we and others have identified several c-Jun target genes (7-12), the precise molecular mechanisms by which c-Jun/AP-1 mediates biological processes are yet to be determined.
The HMG-I/Y gene encodes the HMG-I and HMG-Y protein isoforms, which result from alternatively spliced mRNA (13, 14). HMG-I and HMG-Y proteins differ by an internal 11 amino acids present only in the HMG-I isoform (13, 14). Both HMG-I and HMG-Y proteins contain AT hook DNA binding domains that mediate binding to AT-rich sequences in the minor groove of chromosomal DNA (15-19). These proteins appear to play an important role in regulating gene expression (15-25) and have been called architectural transcription factors because they alter the conformation of DNA by modulating nuclear protein-DNA complexes. HMG-I/Y proteins also physically interact with transcription factors such as AP-1, nuclear factor-
B (20), Sp1, and CAAT/enhancer binding protein-ß (21) to modulate their ability to activate gene expression.
HMG-I/Y is localized to the short arm of chromosome 6 in a region commonly involved in chromosomal abnormalities associated with human cancers (13, 14, 26). HMG-I/Y expression is increased in neoplastic transformation and proliferation (27-33). Increased expression of HMG-I/Y mRNA and/or protein has also been associated with numerous human malignancies (34-37) as well as mouse models of skin (38) and prostate carcinoma (39) and is also associated with metastasis (40, 41). In addition, HMG-I/Y may play a direct role in tumorigenesis by interfering with the ability of p53 to recognize damaged DNA (42). It also cooperates with AP-1 and CBP/p300 in transcription of HPV18 sequences (43).
A previous study has shown that HMG-I/Y is a c-Myc target gene important in transformation in Burkitt's lymphoma (33). HMG-I/Y also has several oncogenic properties (33, 36, 44, 45). Increased expression of HMG-I/Y in Rat1a cells, human lymphoid cells (33), or human breast cells (36, 44) results in a transformed phenotype. In addition, rat cells overexpressing HMG-I/Y form tumors in nude mice (33, 45). HMGI-I/Y was also shown to be induced by phorbol esters, although this induction was relatively modest (46). We used our previously reported Rat1a cell system in which c-Jun expression is regulated by doxycycline (9) to examine whether HMG-I/Y is a target gene involved in c-Juninduced transformation and anchorage-independent growth. We report that c-Jun binds to the AP-1 site at position 1,091 in the HMG-I/Y promoter and enhances HMG-I/Y expression under nonadherent growth conditions. Inhibition of HMG-I/Y expression by an antisense construct inhibits transformation by c-Jun in soft agarose, and overexpression of HMG-I/Y alone allows cells to grow in an anchorage-independent manner. Taken together, these results indicate that HMG-I/Y is a c-Jun target gene that is necessary, and partially sufficient, for c-Juninduced transformation and anchorage-independent growth of Rat1a cells.
 |
Results
|
|---|
HMG-I/Y Transcription Is Increased in the Presence of c-Jun Overexpression
We have previously shown that overexpression of c-Jun in Rat1a cells results in the activation of target genes, many of which may have roles in proliferation and transformation (9, 10). HMG-I/Y is a likely candidate for regulation by c-Jun/AP-1 because several potential AP-1 binding sites have been identified in its promoter (33, 46, 47). To determine the effect of c-Jun on HMG-I/Y expression, we used Rat1a cells with doxycycline-inducible c-Jun expression (9). Northern blot analysis showed that HMG-I/Y transcription was considerably up-regulated following c-Jun induction in cells grown in nonadherent conditions for 48 hours, while a GFP-expressing control cell line showed no change (Fig. 1A). This regulation was observed in two independent c-Junexpressing clones, Rat1a-J2 (data not shown) and Rat1a-J4. These results were confirmed by Western blot analysis showing a concomitant increase in HMG-I/Y protein following c-Jun induction (Fig. 1B). There was no change in the relative ratios of HMG-I and HMG-Y isoforms under c-jun induction (data not shown). The increase in basal HMG-I/Y expression in Rat1a-J4 cells (dox) compared with GFP control cells is likely due to leakiness of c-Jun expression in the absence of doxycycline.
c-Jun/AP-1 Binds to a Consensus AP-1 Binding Site in the HMG-I/Y Promoter
In addition to the E-box at 1,337 and AP-2 site at 1,321 in the mouse HMG-I/Y promoter (33, 47), three potential AP-1 binding sites are located at 1,457, 1,423, and 1,091 (Fig. 2A; refs. 46, 47). To determine if HMG-I/Y is a target for regulation by c-Jun/AP-1, we analyzed these potential AP-1 binding sites by in vitro gel mobility shift assays. All three oligomers showed DNA-protein interactions with nuclear extracts isolated from Rat1a-J4 cells grown in the absence and presence of doxycycline (Fig. 2B). The oligomers corresponding to the "AP-1 sites" at positions 1,457 and 1,091 had increased protein complex binding in the presence of doxycycline, suggesting that c-Jun/AP-1 may interact at these locations. The 1,091 oligomer, in particular, showed increased binding and migration of two complexes in the doxycycline-treated cell extracts. To determine if c-Jun is contained in the DNA-protein complexes at 1,457 and 1,091, we performed supershift analysis with an antibody against c-Jun. The complex binding at 1,457 was not supershifted, suggesting that c-Jun is not contained in the complex (Fig. 2C). Similarly, no supershifted complexes were detected at 1,423 (data not shown). Supershifted complexes were detected, however, at 1,091, and both complexes detected in doxycycline-induced extracts were supershifted (Fig. 2D). The complex binding at 1,091 was also supershifted by an antibody to JunD, suggesting that JunD, in addition to c-Jun, was a component of the complex (Fig. 2E). In the presence of doxycycline, the amount of the complex supershifted by the c-Jun antibody increased and that by the JunD antibody decreased; in addition, a supershifted band was detected with an antibody against Fra1 (Fig. 2E). An isotype control antibody did not result in any reproducibly supershifted complexes. These results suggest that c-Jun is a component of the complex interacting at 1,091 in the HMG-I/Y promoter, and in the presence of induced c-Jun, this complex is altered.

View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 2. AP-1 binding at the HMG-I/Y promoter. A. The mouse HMG-I/Y promoter contains three potential AP-1 binding sites located at positions 1,457, 1,423, and 1,091. The E-box is located at 1,337, and an AP-2 binding site is located at 1,321. The translational initiation site is located at +2,600, producing a 2.6-kb 5' untranslated region. B. Gel mobility shift assay using the potential AP-1 binding sites as probes with Rat1a-J4 nuclear proteins extracted from cells grown in the absence () and presence (+) of doxycycline to induce c-Jun expression. Arrows, DNA-protein complex formations. C. Gel shifts showing competition for complex formation with the oligomer containing 1,457 with cold wild-type oligomer and a mutated oligomer. Incubation with antibodies against c-Jun, however, does not result in a supershifted complex. D. Gel shifts showing competition for the DNA-protein complex formation at the AP-1 site located at 1,091 with wild-type oligomer and not the mutated oligomer. The complexes detected in doxycycline-treated nuclear extracts (arrows) were supershifted with the antibody against c-Jun. E. AP-1 complex composition at the 1,091 site in the absence () and presence (+) of doxycycline (2 µg/mL). Nuclear extracts were incubated with an end-labeled AP-1 probe and specific antibodies to various Jun and Fos family members as well as an isotype control antibody (lanes 2 and 9). Arrows, supershifted complexes.
|
|
c-Jun/AP-1 Activates the HMG-I/Y Promoter Through the AP-1 Site at 1,091
To further determine if AP-1 could activate HMG-I/Y transcription in cells, we performed transfection experiments and promoter analysis in Rat1a, Rat1a-GFP, and Rat1a-J4 cells. Transient transfection of Rat1a cells with a 1,895 to +75 HMG-I/Y promoter luciferase construct in combination with the doxycycline-inducible pLRT-c-Jun plasmid resulted in a significant increase in promoter activity (Fig. 3A). In contrast to HMG-I/Y promoter activation by c-Jun, the AP-1 dominant negative mutant Tam67 had no effect (Fig. 3A). Transfection of the 1,895 to +75 HMG-I/Y promoter construct into Rat1a-J4 cells resulted in a significant increase in promoter activity in the presence of doxycycline (Fig. 3B). This increase in promoter activity was prevented by mutation of the AP-1 site at 1,091. In addition, deletion of the region 1,895 to 974 containing the E-box, AP-1 and AP-2 sites, also prohibited promoter activation by c-Jun/AP-1 (Fig. 3B). The slight increase in induced promoter activity seen in the truncated promoter construct may reflect the loss of an inhibitory element for which we have preliminary evidence.3 No increase in promoter activity in the presence of doxycycline was observed for any of the constructs when transfected into the control Rat1a-GFP cells (Fig. 3B). Taken together, these results suggest that the AP-1 site at 1,091 and sequences upstream of 974 are important for c-Jun/AP-1 regulation of the HMG-I/Y promoter.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 3. c-Jun/AP-1 regulation of the HMG-I/Y promoter. A. Rat1a cells were transiently cotransfected with pLRT-c-Jun or the AP-1 dominant negative mutant construct, pLRT-Tam67, and the 1,895 to +75 HMG-I/Y promoter fused to the luciferase reporter gene. Control, luciferase activities in cells transfected with one reporter alone. Columns, mean of triplicate experiments; bars, SD. B. Rat1a-J4 and Rat1a-GFP cells were transfected with HMG-I/Y promoter luciferase constructs representing 1,895 to +75, 1,895 to +75 with a mutated AP-1 site at 1,091, and a deletion construct representing 974 to +75. Luciferase activities are expressed relative to Renilla luciferase activity as a control for transfection efficiency. Columns, mean of triplicate experiments; bars, SD.
|
|
HMG-I/Y Expression Is Required for c-Jun/AP-1Induced Anchorage-Independent Growth
To determine if HMG-I/Y is necessary for c-Junregulated anchorage-independent growth, we isolated pools of independent isolated clones of Rat1a-J4 cells with constitutive antisense HMG-I/Y expression. The antisense expression suppressed the c-Juninduced nonadherent cell growth of J4 cells (Fig. 4A). Each pool of antisense clones was suppressed
80% compared with the cloning of the parental cell line. The colonies were smaller, and the number of colonies was significantly reduced compared with those of c-Junexpressing Rat1a-J4 cells. No suppression of cloning was observed for a pool of Rat1a-J4 cells transfected with the pSG5 vector alone (Fig. 4A). In addition, the pools expressing antisense HMG-I/Y demonstrated
50% suppression of HMG-I/Y when determined by Western blot (Fig. 4B). Western blot analysis of HMG-C demonstrated no change in expression (data not shown). Constitutive expression of antisense HMG-I/Y did not affect the growth rate of the cells. The pools of Rat1a-J4 cells overexpressing antisense HMG-I/Y had a comparable doubling time to parental Rat1a-J4 cells both in the presence and in the absence of doxycycline (data not shown). Further, we isolated two independent clones of Rat1a-J4-asHMG-I/Y and tested them for their ability to clone in soft agarose. J4HMGas-9 and J4HMGas-23 were suppressed in their ability to grow in soft agarose (>90%; Fig. 4C), whereas two independent Rat1a-J4 clones transfected with the pSG5 vector alone were not. Western blot analysis demonstrated suppression of HMG-I/Y expression (Fig. 4D). The discrepancy in colony formation between the antisense HMG-I/Y-expressing pools and clones (compare Fig. 4A and D) was due to leakiness of HMG-I/Y expression in the pool cells. HMG-I/Y expression in the antisense clones was reduced by 98% (Fig. 4D). These results indicate that HMG-I/Y expression in Rat1a-J4 cells is necessary for anchorage-independent growth by c-Jun.

View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 4. Antisense HMG-I/Y inhibits c-Junregulated anchorage-independent growth. A. Colony formation in Rat1a-J4 control (dox), c-Junexpressing clones (+dox), and pools of Rat1a-J4 pSG5 and Rat1a-J4-asHMG-I/Y clones after growth for 14 days in soft agarose. Columns, mean of triplicate experiments; bars, SD. Right, colony size. B. HMG-I/Y protein levels in Rat1a-J4 and pools of Rat1a-J4-asHMG-I/Y after normalization using tubulin levels to control for loading differences. Antisense HMG-I/Y decreases the HMG-I/Y protein levels by 50%. C. Colony formation in Rat1a-J4 control (dox), c-Junexpressing clones (+dox), and two clones of Rat1a-J4 pSG5 and Rat1a-J4-asHMG-I/Y (J4HMGas#9 and J4HMGas#23) after growth for 14 days in soft agarose. Right, colony size. D. Western blot analysis of HMG-I/Y expression in Rat1a-J4 cells (dox or +dox) and Rat1a-J4-asHMG-I/Y clones after treatment for 7 days with doxycycline. The nonspecific band below HMG-I/Y was consistent between experiments, and its level was not altered in the presence of doxycycline.
|
|
Because our antisense experiments indicated that HMG-I/Y is required for transformation by c-Jun in this system, we next sought to determine if HMG-I/Y was sufficient for transformation in our Rat1a cells. The overexpression of HMG-I/Y in Rat1a cells induced colony formation (Fig. 5B), although the colonies were slightly smaller, less compact, and fewer than those induced by c-Jun overexpression. This is similar to that reported previously (33, 45).

View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 5. HMG-I/Y overexpression in Rat1a cells induces soft agarose colony formation. A. Western blots showing expression of HMG-I/Y in Rat1a-HMG-I/Y cells compared with parental Rat1a and vector control Rat1a-pSG5 cells. B. Number of colonies observed in Rat1a, Rat1a-pSG, Rat1a-HMG-I, and Rat1a-HMG-Y after 14 days of growth in soft agarose.
|
|
 |
Discussion
|
|---|
In this article, we show that c-Jun binds to the HMG-I/Y promoter and induces expression of the HMG-I/Y chromatin binding protein. Decreasing HMG-I/Y proteins using an antisense approach inhibits c-Jun/AP-1induced transformation, while overexpression of HMG-I/Y confers anchorage-independent cell growth. The colonies in Rat1a cells overexpressing HMG-I/Y were smaller and fewer, suggesting that HMG-I/Y expression only partially recapitulates the c-Jun/AP-1 phenotype. HMG-I/Y is a chromatin remodeling protein with DNA binding domains called AT hooks, which bind to the minor groove of stretches of AT-rich DNA (13-21, 26). Several studies suggest an important role for HMG-I/Y in regulating gene transcription (13-26, 42-44). The HMG-I/Y gene is highly conserved among species; the transcribed regions of the human and mouse HMG-I/Y genes are
80% identical at the nucleotide sequence level and >90% identical when only the protein-coding exons are considered (48). Both mouse and human HMG-I/Y promoters have a consensus AP-1 site at position 1,091 (47). The conservation of this site reflects the importance of the transcription factor binding site in the regulation of this gene. Ogram and Reeves (46) demonstrated that the AP-1 complex regulates HMG-I/Y expression during differentiation of human K562 erythroleukemic cells after treatment with 12-O-tetradecanoylphorbol-13-acetate. However, promoter analysis in this case revealed that a variant AP-1 site with one-base mismatch (TGACACA) within the human HMG-I/Y promoter was responsible for 12-O-tetradecanoylphorbol-13-acetate induction. This site (which is conserved within the mouse promoter) was downstream to the promoter sequence used for our studies. The variant AP-1 site was not included in our studies because it is in a region of the HMG-I/Y promoter that is not responsive to serum or growth factor stimulation in murine fibroblasts. Thus, it may not contribute to the induction of HMG-I/Y in response to growth-regulatory signals. Our gel mobility shift and reporter assays demonstrated that the AP-1 site at position 1,091 is a novel and critical element for c-Jun/AP-1 up-regulation of HMG-I/Y. Likely, the usage of different AP-1 sites depends in part on the transcriptional milieu, which in turn reflects the biological system being tested.
There is substantial evidence supporting the role of HMG-I/Y in cellular transformation and human malignancy. HMG-I/Y is expressed at low levels in normal or differentiated cells while higher in response to a wider range of growth factors (30, 49-52). HMG-I/Y is a direct target of the c-myc oncogene. Moreover, HMG-I/Y is necessary for c-mycmediated transformation in Burkitt's lymphoma cells, a c-mycdriven human malignancy. Further, expression of HMG-I/Y in nontumorigenic breast cells converts them to a tumorigenic state (44). Previous work has demonstrated that several malignant tumors have aberrant expression of HMG-I/Y proteins (26-41, 48, 53, 54). In addition, use of an adenovirus carrying the mouse HMG-I/Y gene in an antisense orientation suppressed HMG-I/Y protein synthesis and induced programmed cell death of a human thyroid anaplastic carcinoma cell line ARO (54). Interestingly, in the ARO cell line, c-Jun, JunD, Fra1, and AP-1 binding activities are all increased (55).
Critical to our understanding of how c-Jun/AP-1 mediates such diverse biological actions is to precisely identify its mechanisms of transcriptional activity and its relevant "downstream" targets. c-Jun/AP-1 regulates the expression of a myriad of genes (9, 10, 56). Many of these genes are direct transcriptional targets for c-Jun/AP-1 with AP-1 consensus sequences within their promoters. Determining the relevance of these genes for a given biological activity has proven more difficult. We have previously characterized the c-Junresponsive genes in Rat1a cells using microarrays (9, 10) and demonstrated that several of these genes are necessary for nonadherent cell growth. HMG-I/Y is clearly another one and perhaps the most intriguing. Not only is HMG-I/Y expression necessary for c-Jun/AP-1induced nonadherent cell growth, forced expression of the gene produces transformation of Rat1a cells. Thus, HMG-I/Y appears to partially recapitulate the biological system. The precise role of c-Jun/HMG-I/Y in the nonadherent growth of Rat1a cells remains to be defined. Because there is no effect on cellular proliferation of antisense HMG-I/Y, c-Jun/HMG-I/Y acts by a different mechanism(s). Rat1a cells undergo anoikis when in the nonadherent state, and c-Jun/HMG-I/Y may be inhibiting this process. Further, the role of HMG-I/Y in chromatin remodeling (15-19, 22-26) suggests a new and novel way in which c-Jun/AP-1 can regulate gene expression. c-Jun/AP-1induced expression of HMG-I/Y may result in alterations in chromatin structure and in turn availability of c-Jun/AP-1regulated targets. Of interest, genes that are induced by HMG-I/Y expression include many genes involved in the extracellular matrix including the matrix metalloproteinases and collagen genes (44, 57, 58), which are also AP-1regulated genes (59-62). This suggests that HMG-I/Y may mediate some of the downstream AP-1 effects. In fact, direct interactions between HMG-I/Y and AP-1 components have been described (17, 20, 63-65). A systematic comparison of genes up-regulated by HMG-I/Y and AP-1 might identify genes with transcription dependent on c-Jun induction of HMG-I/Y.
In conclusion, the results in this article establish that HMG-I/Y is a direct target of c-Jun/AP-1. In Rat1a cells, up-regulation of HMG-I/Y is necessary and partially sufficient for c-Juninduced nonadherent cell growth.
 |
Materials and Methods
|
|---|
Cells and Cell Culture
Rat1a cells expressing either c-Jun (Rat1a-J2 and Rat1a-J4) or green fluorescent protein (Rat1a-GFP) in a doxycycline-controlled manner have been described previously (9). All cells were maintained in DMEM (Invitrogen Life Technologies, Inc., Carlsbad, CA) supplemented with 10% fetal bovine serum (Gemini Bio-Products, Woodland, CA) and 1% L-glutamine (Invitrogen Life Technologies). For nonadherent growth, cells were plated in PolyHeme-coated dishes in the presence or absence of doxycycline (2 µg/mL) to induce c-Jun expression.
Reporter Constructs and Expression Plasmids
A 2-kb HindIII/BamHI fragment from the 4.6-kb HMG-I/Y-GH plasmid (33) was subcloned into pBluescript II KS. The resulting plasmid was digested with KpnI and BamHI, and the released fragment was cloned into pGL2-basic (Promega, Madison, WI). This plasmid was designated pGL2 HMG-I/Y1,895/+75. A 5' deletion fragment of the HMG-I/Y promoter from 974 to +75 was cloned into pBluescript II KS using HindIII and BamHI. A 1.1-kb KpnI/BamHI fragment from HMG-I/Y974/+75 pBluescript II KS was subcloned into pGL2-basic and designated pGL2 HMG-I/Y974/+75. The plasmid pGL2 HMG-I/Y1,895/+75 AP-1 mutant was created by mutating the AP-1 consensus site in the HMG promoter in plasmid pGL2 HMG-I/Y1,895/+75. The site was mutated using the GeneEditor in vitro site-directed mutagenesis system (Promega) according to the manufacturer's recommendations with the following oligonucleotide with the mutated bases italicized: GGGGAACAGAGTTATCTCGAGCAGTCGTGTGTCACT. The plasmid expressing murine HMG-I in the antisense orientation (pSG5-AS-HMG-I) was made by cloning an HMG-I BamHI fragment (a gift from J. Maher, Jackson, MS) in the antisense orientation into pSG5 at the same site. pLRT-c-Jun, pLRT-Tam67, pSG5-HMG-I, and pSG5-HMG-Y have been described previously (9, 16).
Northern Blot Analysis
Total cellular RNA from Rat1a-J2, Rat1a-J4, and Rat1a-GFP cells was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Total RNA (1 µg) was separated on 1% agarose gels and transferred to nitrocellulose membranes. The membranes were probed with [
-32P]dCTP-labeled cDNA probes, and the signal was detected by autoradiography. The cDNA probe for HMG-I was obtained from pSG5-HMG-I (33), and that for c-jun was obtained from pBlue-c-jun (10).
Western Blot Analysis
Cell lysates from Rat1a-J4 and Rat1a-GFP cells grown in the absence or presence of doxycycline (2 µg/mL) were prepared by lysing the cells in radioimmunoprecipitation assay buffer [150 mmol/L NaCl, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 10 mmol/L Tris (pH 7.4)] supplemented with 0.1 mmol/L phenylmethylsulfonyl fluoride, 100 µg/mL aprotinin, and 100 µg/mL leupeptin. The cell lysates were sonicated and centrifuged to remove debris, and protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). Equal amounts of protein were separated on 12% or 15% SDS gels, transferred to nitrocellulose membranes (PROTRAN, Schleicher & Schuell, Keene, NH), and incubated with the following antibodies: anti-HMG-I/Y antibody (29), anti-c-Jun (sc45x), and anti-ß-tubulin (sc9104, Santa Cruz Biotechnology, Santa Cruz, CA). The signal was detected by enhanced chemiluminescence.
Transient Transfections and Luciferase Reporter Assays
Exponentially growing Rat1a-J4 or Rat1a cells were seeded at a density of 3 x 105 cells per 60 mm dish. The cells were transfected with 1 µg HMG-I/Y promoter reporter constructs using FuGene6 Transfection Reagent (Roche Diagnostics Corp., Indianapolis, IN). Forty nanograms of Renilla luciferase (Promega) were cotransfected to control for transfection efficiency. After overnight incubation, cells were trypsinized and plated under nonadherent growth conditions in PolyHeme-coated 12-well dishes in the presence or absence of doxycycline (2 µg/mL). Luciferase activity was measured 2 days after induction with doxycycline using the Dual-Luciferase Reporter Assay System (Promega).
Gel Mobility Shift and Supershift Assays
Nuclear proteins were prepared from Rat1a-J4 cells grown for 3 days under nonadherent conditions in the presence or absence of doxycycline (2 µg/mL) as described previously (66). Briefly, cells were pelleted and washed once with cold PBS. The cell pellet was resuspended in five packed volumes of 10 mmol/L HEPES (pH 7.9), 1.5 mmol/L MgCl2, 10 mmol/L KCl, and 0.5 mmol/L DTT and allowed to swell on ice for 10 minutes. The cells were lysed by slow uptake and rapid ejection (5x) through a 25 gauge needle. Nuclei were pelleted and resuspended in one-third volume of 20 mmol/L HEPES (pH 7.9), 25% glycerol, 0.45 mol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5 mmol/L phenylmethylsulfonyl fluoride, 100 µg/mL aprotinin, and 1 µg/mL leupeptin and rotated for 30 minutes at 4°C. The resulting nuclear proteins were dialyzed against 50 volumes of 20 mmol/L HEPES (pH 7.9), 25% glycerol, 0.1 mol/L KCl, 0.2 mmol/L EDTA, 0.5 mmol/L phenylmethylsulfonyl fluoride, and 1 µg/mL each of aprotinin and leupeptin for 2 hours at 4°C. Supernatants were stored at 70°C, and protein concentrations were determined as described above. Five micrograms of nuclear extract were incubated with 2 µg of poly-deoxyinosinic-deoxycytidylic acid and 4 µL of incubation buffer [100 mmol/L HEPES (pH 7.9), 250 mmol/L KCl, 2.5 mmol/L EDTA, 5 mmol/L MgCl2, and 20% Ficoll 400] in a final volume of 20 µL for 10 minutes on ice prior to the addition of double-stranded oligonucleotides labeled with [
-32P]ATP. The protein-DNA mixtures were incubated on ice for a further 20 minutes and separated on nondenaturing 5% polyacrylamide gels at 180 volts for 2 to 3 hours at 4°C in 0.5x Tris-borate EDTA. Unlabeled (100 ng) wild-type or mutated oligonucleotides were used as competitors to confirm the specificity of the complexes formed. The following oligonucleotides corresponding to the murine HMG-I/Y promoter were used as probes: AP-1like (1), wild-type GCCCCTCCATGACTTCCTCCTTCTCCA and mutated GCCCCTCCATGGCTTGCTCCTTCTCCA; AP-1like (2), wild-type CCCTGGAACTGAGGGTCACCTGGACC and mutated CCCTGGAACTGGGTGTCACCTGGACC; and AP-1, wild-type GGAACAGAGTTATGAGTCACAGTCGTGTGT and mutated GGAACAGAGTTATGGGTTGCAGTCGTGTGT.
For supershift assays, antibodies (sc45x, sc46x, sc74x, sc52x, and sc605x, Santa Cruz Biotechnology) were added to the DNA-protein mixture and incubated on ice for 20 minutes prior to the addition of the probe.
Colony-Forming Assays
Cells (1 x 104) were plated in triplicate in 6 mL of 0.35% agarose (Sea Plaque, FMC Bioproducts, Rockland, ME) in complete growth medium in the presence or absence of doxycycline (2 µg/mL) overlaid on a 0.7% agarose base, also in complete growth medium, and incubated for 2 to 3 weeks at 37°C. Colonies were stained with p-iodonitrotetrazolium violet (1 mg/mL) and counted using a GS710 Calibrated Imaging Densitometer and Quantity One software (Bio-Rad).
 |
Notes
|
|---|
3 L.M.S. Resar, unpublished results. 
Received January 28, 2004;
revised April 30, 2004;
accepted May 11, 2004.
 |
References
|
|---|
- Alani R, Brown P, Binetruy B, et al. The transactivating domain of the c-Jun proto-oncoprotein is required for cotransformation of rat embryo cells. Mol Cell Biol 1991;11:6286-95.[Abstract/Free Full Text]
- Hartl M, Bister K. Specific activation in jun-transformed avian fibroblasts of a gene (bkj) related to the avian ß-keratin gene family. Proc Natl Acad Sci USA 1995;92:11731-5.[Abstract/Free Full Text]
- Wisdom R, Johnson RS, Moore C. c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms. EMBO J 1999;18:188-97.[CrossRef][Medline]
- Szabo E, Preis LH, Brown PH, Birrer MJ. The role of jun and fos gene family members in 12-O-tetradecanoylphorbol-13-acetate induced hemopoietic differentiation. Cell Growth & Differ 1991;2:475-82.[Abstract]
- Bossy-Wetzel E, Bakiri L, Yaniv M. Induction of apoptosis by the transcription factor c-Jun. EMBO J 1997;16:1695-709.[CrossRef][Medline]
- Schutte J, Minna JD, Birrer MJ. Deregulated expression of human c-jun transforms primary rat embryo cells in cooperation with an activated c-Ha-ras gene and transforms rat-1a cells as a single gene. Proc Natl Acad Sci USA 1989;86:2257-61.[Abstract/Free Full Text]
- Bakiri L, Lallemand D, Bossy-Wetzel E, Yaniv M. Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression. EMBO J 2000;19:2056-68.[CrossRef][Medline]
- Hartl M, Reiter F, Bader AG, Castellazzi M, Bister K. JAC, a direct target of oncogenic transcription factor Jun, is involved in cell transformation and tumorigenesis. Proc Natl Acad Sci USA 2001;98:13601-6.[Abstract/Free Full Text]
- Kinoshita I, Leaner V, Katabami M, et al. Identification of cJun-responsive genes in Rat-1a cells using multiple techniques: increased expression of stathmin is necessary for cJun-mediated anchorage-independent growth. Oncogene 2003;22:2710-22.[CrossRef][Medline]
- Leaner VD, Kinoshita I, Birrer MJ. AP-1 complexes containing cJun and JunB cause cellular transformation of Rat1a fibroblasts and share transcriptional targets. Oncogene 2003;22:5619-29.[CrossRef][Medline]
- Schreiber M, Kolbus A, Piu F, Szabowski A, et al. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev 1999;13:607-19.[Abstract/Free Full Text]
- Vogt PK. Jun, the oncoprotein. Oncogene 2001;20:2365-77.[CrossRef][Medline]
- Friedmann M, Holth LT, Zoghbi HY, Reeves R. Organization, inducible-expression and chromosome localization of the human HMG-I(Y) nonhistone protein gene. Nucleic Acids Res 1993;21:4259-67.[Abstract/Free Full Text]
- Johnson KR, Cook SA, Davisson MT. Chromosomal localization of the murine gene and two related sequences encoding high-mobility-group I and Y proteins. Genomics 1992;12:503-9.[CrossRef][Medline]
- Falvo JV, Thanos D, Maniatis T. Reversal of intrinsic DNA bends in the IFN ß gene enhancer by transcription factors and the architectural protein HMG I(Y). Cell 1995;83:1101-11.[CrossRef][Medline]
- Maher JF, Nathans D. Multivalent DNA-binding properties of the HMG-1 proteins. Proc Natl Acad Sci USA 1996;93:6716-20.[Abstract/Free Full Text]
- Thanos D, Maniatis T. The high mobility group protein HMG I(Y) is required for NF-
B-dependent virus induction of the human IFN-ß gene. Cell 1992;71:777-89.[CrossRef][Medline]
- Thanos D, Maniatis T. Virus induction of human IFN ß gene expression requires the assembly of an enhanceosome. Cell 1995;83:1091-100.[CrossRef][Medline]
- Dragan AI, Crane-Liggins JR, Robinson C, Privalov PL. The energetics of specific binding of AT-hooks from HMGA1 to target DNA. J Mol Biol 2003;327:393-411.[CrossRef][Medline]
- Himes SR, Reeves R, Attema J, Nissen M, Li Y, Shannon MF. The role of high-mobility group I(Y) proteins in expression of IL-2 and T cell proliferation. J Immunol 2000;164:3157-68.[Abstract/Free Full Text]
- Foti D, Iuliano R, Chiefari E, Brunetti A. A nucleoprotein complex containing Sp1, C/EBPß, and HMGI-Y controls human insulin receptor gene transcription. Mol Cell Biol 2003;23:2720-32.[Abstract/Free Full Text]
- Zhou K, Kas E, Gonzalez E, Laemmli UK. SAR-dependent mobilization of histone H1 by HMG-I/Y in vivo: HMG-I/Y is enriched in H1-depleted chromatin. EMBO J 1993;12:3237-47.[Medline]
- Saitith Y, Laemmli UK. Metaphase chromosome structure: bands arise from a differential folding path of the highly AT-rich scaffold. Cell 1994;79:609-22.
- Strick R, Laemmli UK. SARs are cis DNA elements of chromosome dynamics: synthesis of a SAR repressor protein. Cell 1995;83:1137-48.[CrossRef][Medline]
- Girard F, Bello B, Laemmli UK, Gehring WJ. In vivo analysis of scaffold-associated regions in Drosophila: a synthetic high-affinity SAR binding protein suppresses position effect variegation. EMBO J 1998;17:2079-85.[CrossRef][Medline]
- Takaha N, Hawkins AL, Griffin CA, Isaacs WB, Coffey DS. High mobility group protein I(Y): a candidate architectural protein for chromosomal rearrangements in prostate cancer cells. Cancer Res 2002;62:647-51.[Abstract/Free Full Text]
- Chiappetta G, Bandiera A, Berlingieri MT, et al. The expression of the high mobility group HMGI (Y) proteins correlates with the malignant phenotype of human thyroid neoplasias. Oncogene 1995;10:1307-14.[Medline]
- Giancotti V, Bandiera A, Ciani L, et al. High-mobility-group (HMG) proteins and histone H1 subtypes expression in normal and tumor tissues of mouse. Eur J Biochem 1993;213:825-32.[Medline]
- Giancotti V, Buratti E, Perissin L, et al. Analysis of the HMGI nuclear proteins in mouse neoplastic cells induced by different procedures. Exp Cell Res 1989;184:538-45.[CrossRef][Medline]
- Ram TG, Reeves R, Hosick HL. Elevated high mobility group-I(Y) gene expression is associated with progressive transformation of mouse mammary epithelial cells. Cancer Res 1993;53:2655-60.[Abstract/Free Full Text]
- Tamimi Y, van der Poel HG, Denyn MM, et al. Increased expression of high mobility group protein I(Y) in high grade prostatic cancer determined by in situ hybridization. Cancer Res 1993;53:5512-6.[Abstract/Free Full Text]
- Tamimi Y, van der Poel HG, Karthaus HF, Debruyne FM, Schalken JA. A retrospective study of high mobility group protein I(Y) as progression marker for prostate cancer determined by in situ hybridization. Br J Cancer 1996;74:573-8.[Medline]
- Wood LJ, Mukherjee M, Dolde CE, et al. HMG-I/Y, a new c-Myc target gene and potential oncogene. Mol Cell Biol 2000;20:5490-502.[Abstract/Free Full Text]
- Abe N, Watanabe T, Izumisato Y, et al. Diagnostic significance of high mobility group I(Y) protein expression in intraductal papillary mucinous tumors of the pancreas. Pancreas 2002;25:198-204.[CrossRef][Medline]
- Chiappetta G, Manfioletti G, Pentimalli F, et al. High mobility group HMGI(Y) protein expression in human colorectal hyperplastic and neoplastic diseases. Int J Cancer 2001;91:147-51.[CrossRef][Medline]
- Dolde CE, Mukherjee M, Cho C, Resar LM. HMG-I/Y in human breast cancer cell lines. Breast Cancer Res Treat 2002;71:181-91.[CrossRef][Medline]
- Nam ES, Kim DH, Cho SJ, et al. Expression of HMGI(Y) associated with malignant phenotype of human gastric tissue. Histopathology 2003;42:466-71.[CrossRef][Medline]
- Rajeswari MR, Singh D, Jain A, Ray R. Elevated levels of high-mobility-group chromosomal proteins, HMGA1, in murine skin carcinoma. Cancer Lett 2001;173:93-9.[CrossRef][Medline]
- Leman ES, Madigan MC, Brunagel G, Takaha N, Coffey DS, Getzenberg RH. Nuclear matrix localization of high mobility group protein I(Y) in a transgenic mouse model for prostate cancer. J Cell Biochem 2003;88:599-608.[CrossRef][Medline]
- Bussemakers MJ, van de Ven WJ, Debruyne FM, Schalken JA. Identification of high mobility group protein I(Y) as potential progression marker for prostate cancer by differential hybridization analysis. Cancer Res 1991;51:606-11.[Abstract/Free Full Text]
- Tarbe N, Evtimova V, Burtscher H, Jarsch M, Alves F, Weidle UH. Transcriptional profiling of cell lines derived from an orthotopic pancreatic tumor model reveals metastasis-associated genes. Anticancer Res 2001;21:3221-8.[Medline]
- Subramanian D, Griffith JD. Interactions between p53, hMSH2-hMSH6 and HMG I(Y) on Holliday junctions and bulged bases. Nucleic Acids Res 2002;30:2427-34.[Abstract/Free Full Text]
- Bouallaga I, Teissier S, Yaniv M, Thierry F. HMG-I(Y) and the CBP/p300 coactivator are essential for human papillomavirus type 18 enhanceosome transcriptional activity. Mol Cell Biol 2003;23:2329-40.[Abstract/Free Full Text]
- Reeves R, Edberg DD, Li Y. Architectural transcription factor HMGI(Y) promotes tumor progression and mesenchymal transition of human epithelial cells. Mol Cell Biol 2001;21:575-94.[Abstract/Free Full Text]
- Wood LJ, Maher JF, Bunton TE, Resar LM. The oncogenic properties of the HMG-I gene family. Cancer Res 2000;60:4256-61.[Abstract/Free Full Text]
- Ogram SA, Reeves R. Differential regulation of a multipromoter gene. Selective 12-O-tetradecanoylphorbol-13-acetate induction of a single transcription start site in the HMG-I/Y gene. J Biol Chem 1995;270:14235-42.[Abstract/Free Full Text]
- Pedulla ML, Treff NR, Resar LM, Reeves R. Sequence and analysis of the murine Hmgiy (Hmga1) gene locus. Gene 2001;271:51-8.[CrossRef][Medline]
- Reeves R, Beckerbauer L. HMGI/Y proteins: flexible regulators of transcription and chromatin structure. Biochim Biophys Acta 2001;1519:13-29.[Medline]
- Holth LT, Thorlacius AE, Reeves R. Effects of epidermal growth factor and estrogen on the regulation of the HMG-I/Y gene in human mammary epithelial cell lines. DNA Cell Biol 1997;16:1299-309.[Medline]
- Johnson KR, Disney JE, Wyatt CR, Reeves R. Expression of mRNAs encoding mammalian chromosomal proteins HMG-I and HMG-Y during cellular proliferation. Exp Cell Res 1990;187:69-76.[CrossRef][Medline]
- Johnson KR, Lehn DA, Reeves R. Alternative processing of mRNAs encoding mammalian chromosomal high-mobility-group proteins HMG-I and HMG-Y. Mol Cell Biol 1989;9:2114-23.[Abstract/Free Full Text]
- Lanahan A, Williams JB, Sanders LK, Nathans D. Growth factor-induced delayed early response genes. Mol Cell Biol 1992;12:3919-29.[Abstract/Free Full Text]
- Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function. Gene 2001;277:63-81.[CrossRef][Medline]
- Scala S, Portella G, Fedele M, Chiappetta G, Fusco A. Adenovirus-mediated suppression of HMGI(Y) protein synthesis as potential therapy of human malignant neoplasias. Proc Natl Acad Sci USA 2000;97:4256-61.[Abstract/Free Full Text]
- Battista S, de Nigris F, Fedele M, et al. Increase in AP-1 activity is a general event in thyroid cell transformation in vitro and in vivo. Oncogene 1998;17:377-85.[CrossRef][Medline]
- Angel P, Karin M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1991;1072:129-57.[Medline]
- Currie RA. Functional interaction between the DNA binding subunit trimerization domain of NF-Y and the high mobility group protein HMG-I(Y). J Biol Chem 1997;272:30880-8.[Abstract/Free Full Text]
- Liberati C, Sgarra R, Manfioletti G, Mantovani R. DNA binding of NF-Y: the effect of HMGI proteins depends upon the CCAAT box. FEBS Lett 1998;433:174-8.[Medline]
- Chung KY, Agarwal A, Uitto J, Mauviel A. An AP-1 binding sequence is essential for regulation of the human
2(I) collagen (COL1A2) promoter activity by transforming growth factor-ß. J Biol Chem 1996;271:3272-8.[Abstract/Free Full Text]
- Doyle GA, Pierce RA, Parks WC. Transcriptional induction of collagenase-1 in differentiated monocyte-like (U937) cells is regulated by AP-1 and an upstream C/EBP-ß site. J Biol Chem 1997;272:11840-9.[Abstract/Free Full Text]
- Lee JS, See RH, Deng T, Shi Y. Adenovirus E1A downregulates cJun- and JunB-mediated transcription by targeting their coactivator p300. Mol Cell Biol 1996;16:4312-26.[Abstract]
- Westermarck J, Seth A, Kahari VM. Differential regulation of interstitial collagenase (MMP-1) gene expression by ETS transcription factors. Oncogene 1997;14:2651-60.[CrossRef][Medline]
- Du W, Maniatis T. The high mobility group protein HMG I(Y) can stimulate or inhibit DNA binding of distinct transcription factor ATF-2 isoforms. Proc Natl Acad Sci USA 1994;91:11318-22.[Abstract/Free Full Text]
- Du W, Thanos D, Maniatis T. Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements. Cell 1993;74:887-98.[CrossRef][Medline]
- Yie J, Liang S, Merika M, Thanos D. Intra- and intermolecular cooperative binding of high-mobility-group protein I(Y) to the ß-interferon promoter. Mol Cell Biol 1997;17:3649-62.[Abstract]
- Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 1983;11:1475-89.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. P. Kim and G. E. Gallick
Gemcitabine Resistance in Pancreatic Cancer: Picking the Key Players
Clin. Cancer Res.,
March 1, 2008;
14(5):
1284 - 1285.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Cleynen, C. Huysmans, T. Sasazuki, S. Shirasawa, W. Van de Ven, and K. Peeters
Transcriptional Control of the Human High Mobility Group A1 Gene: Basal and Oncogenic Ras-Regulated Expression
Cancer Res.,
May 15, 2007;
67(10):
4620 - 4629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, J. Lu, and E. V. Prochownik
Dual Role for SUMO E2 Conjugase Ubc9 in Modulating the Transforming and Growth-promoting Properties of the HMGA1b Architectural Transcription Factor
J. Biol. Chem.,
May 4, 2007;
282(18):
13363 - 13371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wu, M. Liu, A. Li, H. Donninger, M. Rao, X. Jiao, M. P. Lisanti, A. Cvekl, M. Birrer, and R. G. Pestell
Cell Fate Determination Factor DACH1 Inhibits c-Jun-induced Contact-independent Growth
Mol. Biol. Cell,
March 1, 2007;
18(3):
755 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Katabami, H. Donninger, F. Hommura, V. D. Leaner, I. Kinoshita, J. F. B. Chick, and M. J. Birrer
Cyclin A Is a c-Jun Target Gene and Is Necessary for c-Jun-induced Anchorage-independent Growth in RAT1a Cells
J. Biol. Chem.,
April 29, 2005;
280(17):
16728 - 16738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. D. Leaner, H. Donninger, C. A. Ellis, G. J. Clark, and M. J. Birrer
p75-Ras-GRF1 Is a c-Jun/AP-1 Target Protein: Its Up Regulation Results in Increased Ras Activity and Is Necessary for c-Jun-Induced Nonadherent Growth of Rat1a Cells
Mol. Cell. Biol.,
April 15, 2005;
25(8):
3324 - 3337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Rothermund, K. Rogulski, E. Fernandes, A. Whiting, J. Sedivy, L. Pu, and E. V. Prochownik
C-Myc-Independent Restoration of Multiple Phenotypes by Two C-Myc Target Genes with Overlapping Functions
Cancer Res.,
March 15, 2005;
65(6):
2097 - 2107.
[Abstract]
[Full Text]
[PDF]
|
 |
|