
Molecular Cancer Research 3:14-20 (2005)
© 2005 American Association for Cancer Research
Cancer Genes and Genomics
Nucleotide Sequence Variation Is Frequent in the Mitochondrial DNA Displacement Loop Region of Individual Human Tumor Cells
Haruko Yoneyama1,4,
Toshiko Hara1,
Yo Kato2,
Takao Yamori3,
Etsuko T. Matsuura4 and
Katsuro Koike1
Departments of 1 Gene Research and 2 Pathology, The Cancer Institute, and 3 Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, and 4 Department of Biology, Ochanomizu University, Tokyo, Japan
Requests for reprints: Katsuro Koike, Kitasato Institute for Life Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8641, Japan. Phone: 81-3-5791-6410; Fax: 81-3-5791-6411. E-mail: kkoike{at}jfcr.or.jp
 |
Abstract
|
|---|
The mitochondrial DNA (mtDNA) displacement loop (D-loop) regions of 76 various tumor cell lines were examined to investigate the existence of a specific relationship between a somatic mtDNA sequence and initiation and/or progression of a tumor. Based on molecular cloning-sequencing analysis, a nucleotide sequence in the D-loop region in each cell line was found to be homoplasmic. Several site-specific nucleotide variations were found in stomach and liver tumor cell lines more frequently than those in other tumor cell lines. Subsequently, 20 pairs of noncancerous and cancerous parts from stomach and liver tumor tissues were examined. In the liver tumor tissue, 80% of the noncancerous parts exhibited slightly higher heterogeneity than the corresponding cancerous parts. Several site-specific nucleotide variations found in 76 tumor cell lines were also detected in noncancerous or cancerous parts of stomach and liver tumor tissues. However, it remains unclear why the mtDNA D-loop sequence is homoplasmic in each tumor cell line. The data indicate that mtDNA exhibits heterogeneity even in the noncancerous part and a slight decrease in heterogeneity during tumorigenesis and/or tumor progression. Homoplasmy of the mtDNA population in the tumor cell line would be acquired in the cloning process of establishing a cell line. Site-specific nucleotide substitutions might not be directly involved in the tumorigenesis process.
Key Words: human tumor mtDNA D-loop nucleotide sequence variation homoplasmy heteroplasmy
 |
Introduction
|
|---|
Human mitochondrial DNA (mtDNA) consists of 16,569 bp, comprising a circular dsDNA molecule. The mitochondrial genome encodes 2 rRNAs and 22 tRNAs that are required for intramitochondrial translation. It also encodes 13 polypeptides that are components of the respiratory chain enzyme complexes in the inner membrane of the mitochondria (1). There is a displacement loop (D-loop) region in mtDNA (2), which contains the heavy-strand promoter and light-strand promoter regions (3, 4) as well as the initiation site of heavy-strand replication (2).
There are
103 to 104 mtDNA copies per human cell (5), and the majority of these copies are identical immediately after birth. Because the mitochondria lack protective histones or highly efficient mechanisms for repairing DNA, mammalian mtDNA accumulates mutations at a 10-fold higher rate than does nuclear DNA (6, 7). Because several somatic mutations have been recently identified in human tumors (8-12), examination of mtDNA mutations in various tumor cells is important for understanding the relationship between somatic mtDNA mutation and the initiation and/or progression of a tumor.
In this study, we first analyzed the frequency of nucleotide variation in the D-loop region of mtDNA in each sample derived from various tumor cell lines. The frequencies of nucleotide variation among 76 cell lines were also analyzed to determine whether tumor-specific or tumor typespecific nucleotide changes could be detected. Tumor-specific change in a particular position could not be detected. The sequence homogeneity of the D-loop region in a tumor cell line could therefore be acquired in the process of establishing the cell line from tissue.
Next, we isolated DNA clones from each cancerous and noncancerous part of stomach and liver tumor tissue samples. Sequence analysis of the D-loop region revealed many sequence variations in tumor tissue samples showing nonclonal features of tumor tissue in both cancerous and noncancerous parts. This suggests that the mtDNA population remained heterogeneous in the cancerous part and that site-specific nucleotide variation might not be directly involved in the mechanism of tumorigenesis.
 |
Results
|
|---|
Nucleotide Sequence of the mtDNA D-Loop Region from a Tumor Cell Line Was Identical
Direct sequencing of the PCR product may lose the potential to detect minor mtDNA mutations in the background of large phenotypic expression. In this study, mtDNA was isolated from 76 culture cell lines derived from human stomach (n = 21), liver (n = 13), breast (n = 12), lung (n = 8), brain (n = 6), colon (n = 5), ovary (n = 5), renal (n = 2), prostate (n = 2), melanoma (n = 1), and osteosarcoma (n = 1) tumors. The variation of D-loop DNA in each cell line sample was analyzed initially cell by cell. Pooled PCR products of 1.2-kb fragments were molecularly cloned and subjected to DNA sequencing. The 15 independent DNA clones from each of 76 tumor cell lines were isolated and 1,140 DNA clones (76 x 15) in total were sequenced.
Nucleotide sequences detected in 15 individual D-loop DNA clones were homoplasmic in each cell line, with the exception of the poly-C tracks in D16189 [16,184-16,193 nucleotide position (np)] and D310 (303-315 np) regions. Earlier work showed that the D16189 (16,184-16,193 np) and D310 (303-315 np) regions exhibited polymorphic length variation among individuals (1, 13) as well as nucleotide variation within an individual (14, 15). Substitution of T by C in the 16,189 or 310 np site will generate homopolymer tracts, which are error hotspots originated from polymerase fidelity and DNA slippage during DNA synthesis in vitro (16).
Most of the nucleotide variations were found in two hypervariable regions, which are so-called hotspots (17), and were not uniformly distributed in the D-loop region (Fig. 1). When 21 stomach tumor and 13 liver tumor cell lines were compared with each of the remaining 55 and 63 tumor cell lines, respectively, several site-specific nucleotide variations were found in the stomach (Fig. 2) and liver (Fig. 3) tumor cell lines.

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 1. Frequency of nucleotide variation in the D-loop DNAs isolated from 76 human tumor cell lines. D-loop DNA clones from each of 76 tumor cell lines were sequenced and their nucleotide variation at each site was analyzed. X axis, nucleotide position of mtDNA D-loop region. Numbering of the np is based on the Cambridge sequence deposited in Genbank accession no. J01415. Solid rods, number of nucleotide variation at each position of the D-loop DNA from np16,000 to 16,569 (A) and from np 1 to 600 (B). Open arrows, hypervariable regions HV1 (np 16,024-16,383) and HV2 (np 57-372).
|
|

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 2. Comparison of the frequency of nucleotide variation in the mtDNA D-loop region between stomach and other tumor cell lines. D-loop DNA sequences derived from 21 stomach tumor and 55 other tumor cell lines were analyzed to detect sequence variation at each site. X axis, nucleotide position of mtDNA as described in Fig. 1 legend. Solid rods, frequency of nucleotide variation found in stomach (red) and other tumor (green) cell lines. Several nucleotide positions of >30% frequency in stomach cell line are presented its nucleotide number at each position of the D-loop regions from np 16,000 to 16,569 (A) and from np 1 to 600 (B).
|
|

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 3. Comparison of the frequency of nucleotide variation in the mtDNA D-loop region between liver and other tumor cell lines. D-loop DNA sequences derived from 13 liver tumor and 63 other tumor cell lines were analyzed to detect sequence variation at each site. X axis, nucleotide position of mtDNA as described in Fig. 1 legend. Solid rods, frequency of nucleotide variation found in liver (red) and other tumor (green) cell lines. Several nucleotide positions of >30% frequency in stomach cell line are presented its nucleotide number at each position of the D-loop regions from np 16,000 to 16,569 (A) and from np 1 to 600 (B).
|
|
The frequency of nucleotide variation at sites, such as T146C, C150T, T152C, A16183C, T16189C, C16223T, T16362C, and T16519C, were higher than at other sites. Particularly, at site 16,189 np, the frequency was clearly higher in both cell types. In liver tumor cell lines, 10 of 13 cell lines showed heterogeneity corresponding to 77% and 9 of 21 stomach tumor cell lines were mutated at this site corresponding to 43%. The frequency of some nucleotide variations was higher in the stomach and lower in other tumor cell lines, such as C150T (33%) and T16362C (52%). In contrast, the frequency at site T146C was higher (31%) in the liver and lower (11%) in other tumor cell lines (Fig. 3). Even if some of the nucleotide variations were higher in both stomach and liver tumor cell lines, such as T152C, C16223T, and T16519C, the frequency of nucleotide variation in the two tumor types was different. For instance, at site T16519C, 8 of 21 stomach cell lines were changed corresponding to 38% and 7 of 13 liver cell lines were changed corresponding to 54%. These are considered to be site-specific nucleotide variations of the D-loop regions in stomach and liver tumors. To eliminate the possibility that these nucleotide variations originated from nuclear pseudogenes, we searched the human genome sequence (BLAST; http://www.ncbi.nlm.nih.gov./BLAST/) similar to the D-loop (from 15,971 to 594 np, amplified by two primers used in this study). Pseudogene-like sequences are present in human nuclear DNA; however, these are all
100 bp long and none of the sequences span the whole D-loop region.
Nucleotide Sequence of the mtDNA D-Loop Region from a Tumor Tissue Was Heterogeneous
To examine whether nucleotide variation found in tumor cell lines can be found in the patients' tumor tissues, we prepared D-loop DNAs from 10 pairs of cancerous and noncancerous parts of 10 stomach and 10 liver tumor tissues. The D-loop DNAs of a total of 40 parts were recovered from microdissected, formalin-fixed, and paraffin-embedded specimens. The mtDNA D-loop region was amplified thrice independently with nested PCR. Three PCR products were mixed as described above. Ten D-loop DNA clones were obtained from each sample, and total 400 DNA clones (40 x 10) were sequenced.
Unlike the tumor cell lines, most of the tumor tissue samples carried intracellular variations in the 10 D-loop DNA clones derived from each tumor sample. More specifically, excluding the common nucleotide changes that are unique to each individual tumor tissue sample, one or more additional nucleotide variations were detected in some clones. As shown in Fig. 4, sample 10 revealed that 50% or 90% of DNA clones derived from the cancerous or noncancerous parts, respectively, of one patient showed nucleotide changes that were different from cell specific variation. In contrast, in sample 2, neither cancerous nor noncancerous D-loop DNA clones carry additional changes from cell-specific nucleotide variation. Only 1 of 20 pair samples from stomach and liver tumor tissues was homoplasmic, whereas the other tumor samples were heteroplasmic as can be seen in Figs. 4 and 5. It was regrettable that we could not conduct a chased-back study to determine whether these cell-specific nucleotide variations detected in individual tumor tissue samples were generated from a germ line polymorphism or from clonal development of a somatic mutation from single mtDNA molecules. Furthermore, when 10 clones from noncancerous and cancerous parts of the same tumor tissue sample were compared, the D-loop regions in some noncancerous parts (open rods) were more heterogeneous than those in the cancerous parts (solid rods) as shown in most liver tumor samples (Fig. 5).

View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 4. Number of identical D-loop DNA clones among 10 clones derived from stomach tumor tissues. Ten each D-loop DNA clones isolated from every stomach tumor tissue samples were sequenced to analyze the nucleotide variation. Vertical rods, number of the identical clones isolated from cancerous (solid rods) and noncancerous (open rods) parts. X axis, 10 stomach tumor tissue samples.
|
|

View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
|
FIGURE 5. Number of identical D-loop DNA clones detected in 10 DNA clones derived from liver tumor tissues. Ten each D-loop DNA clones isolated from every liver tumor tissue samples were sequenced to analyze the nucleotide variation. Vertical rods, number of the identical clones isolated from cancerous parts (solid rods) and noncancerous parts (open rods). X axis, 10 liver tumor tissue samples.
|
|
Several site-specific nucleotide diversities detected in stomach and liver tumor cell lines were also found in many D-loop DNA clones derived from the respective tissue samples (Table 1). As can be seen in Table 1, the nucleotide change of C16223T was detected in all clones derived from stomach tumor samples but was less common in the liver tumor group. The T16519C nucleotide change was detected in all DNA clones from liver tumor samples but was less common in the stomach tumor tissue. Although these nucleotide changes are clustered in Asian groups, the so-called Asian haplogroups (18), at least in this study, not all the tumor tissue samples carried these nucleotide changes, although all 20 patients were Japanese. The nucleotide change, T16362C, was detected in 61% of stomach tumor tissue D-loop clones (cancerous part 57 of 100 clones, noncancerous part 65 of 100 clones). The nucleotide change, T16189C, was detected in 50% of liver tumor tissue D-loop clones (cancerous part 50 of 100 clones, noncancerous part 50 of 100 clones) and T146C was detected in 69% of liver tumor tissue clones (cancerous part 66 of 100 clones, noncancerous part 72 of 100 clones). These data are similar to the results found in tumor cell lines. The nucleotide change from T to C at position 16,362 np was detected in 11 cases among 21 stomach tumor cell lines corresponding to 52% (165 of 315 clones) and also was detected in 5 cases among 55 other carcinoma cell lines corresponding to 9% (75 of 825 clones). Likewise, at position 16,189 np, a nucleotide change from T to C was detected in 10 cases among 13 liver tumor cell lines, whereas 13 of 63 other tumor cell lines carried this nucleotide change corresponding to 77% (150 of 195 clones) and 21% (195 of 945 clones), respectively.
View this table:
[in this window]
[in a new window]
|
Table 1. Frequency of Nucleotide Variations in the D-Loop DNA Clones Derived from Stomach and Liver Tumor Tissues
|
|
 |
Discussion
|
|---|
Somatic mtDNA mutations have been studied intensively because of their proposed involvement in the initiation and/or progression of tumors (9-12). It was implied that somatic mtDNA mutations derive from a single nucleotide substitution in individual mtDNA molecules, thereby increasing their population (19). Little is known about how these nucleotide variations were generated in the individual mtDNA D-loop region of various human tumor cells. Indeed, the proportion of the mtDNA sequence necessary for their "phenotypic expression" is in the order of 90% as determined in some reports (20, 21). Similarly, detection of a point mutation is difficult by PCR direct sequencing, when the fraction of mtDNA mutation is <10% in the PCR products.
In the present study using molecular cloning-sequencing analysis, the frequency of nucleotide variation in the mtDNA D-loop regions of each tumor cell line or tumor tissue sample was investigated first; then, the variation among different cell lines or tissue samples was analyzed to determine whether the variation in particular positions of the mtDNA exhibited any tumor features or tumor type specificity. Fifteen independent D-loop DNA clones obtained from each of 76 tumor cell lines were isolated and examined. For each tumor cell line, the nucleotide sequence found in 15 individual D-loop DNA clones was homoplasmic in every cell line.
Most nucleotide variations detected in the D-loop regions were in two hypervariable regions, the so-called hotspots (Fig. 1). Several site-specific-like nucleotide variations were detected in the stomach and liver tumor cell lines, because the frequencies of these variations were clearly higher than those in other tumor cell lines (Figs. 2 and 3) as can be seen at the16,189 np site. Particularly in liver tumor cell lines, 10 of 13 cell lines had substitutions from T to C at this site corresponding to 77% of all tumor cell lines. Although the germ cell lines from the same individuals could not be obtained, the database (GiiB-JST mtSNP; human mitochondrial genome single nucleotide polymorphism) indicates that no such nucleotide variation was found at this site among 99 Japanese. Similarly, at the 152 np site, only
18% among the 99 Japanese have this nucleotide change. On the other hand, 46% of liver tumor cell lines and 33% of stomach cell lines had changes from T to C at this site.
To examine whether site-specific nucleotide changes can be detected in patient tumor tissue, 10 pairs of noncancerous/cancerous parts from stomach and liver tumor tissues were studied. The D-loop DNAs were recovered from microdissected, formalin-fixed, and paraffin-embedded specimens. Because the cell numbers were very small at less than several hundreds and the mtDNAs might have been attached to nonhistone proteins, the greatest difficulty was obtaining sufficient and qualified DNA from the specimens. Furthermore, the DNA double helix may be broken down into smaller fragments or be separated into single strands. It is more difficult to amplify the longer DNA fragments by eliminating several obstacles. However, we successfully amplified the D-loop region with nested PCR. Many nucleotide variations were detected in the cancerous and noncancerous parts of the tumor tissues. Unexpectedly, the nucleotide sequences detected in both cancerous and noncancerous parts from tumor tissue samples appeared to be heterogeneous. Particularly in liver tumor samples, the D-loop region in the noncancerous part exhibited slightly higher heterogeneity than in the corresponding cancerous part (Fig. 5). The data indicate that mtDNA is heteroplasmic in tumor tissues and that the homoplasmy of mtDNA from cultured tumor cells is acquired in the process of cloning a single cell line from the tumor tissue.
It is generally accepted that most cases of chronic hepatitis are caused by hepatitis B and/or C virus infection, which finally results in a high frequency of liver tumor development. Some biochemical or physiologic changes in the mitochondria may induce instability in the mtDNA D-loop regions in both noncancerous and cancerous parts of tumor tissue samples. Several site-specific nucleotide changes detected in the tumor cell lines were found more often in the cancerous and noncancerous parts from stomach and liver tumor tissues. Although it is necessary to investigate whether these nucleotide substitutions have some deleterious effect on the interaction between proteins coded by nuclear genes or affect both mtDNA replication and transcription, the present data strongly suggest that site-specific nucleotide changes might not be directly involved in the mechanism of tumorigenesis.
Finally, it should be mentioned that we could not completely exclude the possibility of DNA slippage during DNA synthesis when performing PCR cloning and sequencing. However, this experimental error is unlikely, as cloning-sequence analysis was conducted first with the 15 independent clones obtained from each of the 76 cell lines and no sequence variation was found, thereby indicating the absence of any such error of DNA synthesis and sequencing. Furthermore, cell lines were established in the past and a detailed background of cell lines could not be followed up retrospectively any further. Therefore, neither normal tissue samples nor blood could be obtained from the original individuals as controls for each respective analysis.
 |
Materials and Methods
|
|---|
Isolation of DNA from Cell Lines
Cells were derived from 76 human cell lines, including stomach (n = 21), liver (n = 13), breast (n = 12), lung (n = 8), brain (n = 6), colon (n = 5), ovary (n = 5), renal (n = 2), prostate (n = 2), melanoma (n = 1), and osteosarcoma (n = 1) lines. The cells were grown in the DMEM supplemented with 10% fetal bovine serum. Cells (
106) of each tumor cell line were harvested and total genomic DNAs were isolated with a column as shown in the Qiagen Blood and Body Fluid Spin Protocol (Qiagen, Inc., Valencia, CA).
Tissue DNA Samples
Tissue DNA samples were prepared from microdissected, formalin-fixed, and paraffin-embedded tissues obtained from the patients. None had received radiation therapy or chemotherapy before the operation. Cancerous and noncancerous parts of tumor tissue sectioned into 10 µm slices on plain glass slides were selected manually and transferred into a 0.5 mL tube containing 350 µL ethanol. After centrifugation at 13,000 x g for 10 minutes, the ethanol was removed and 350 µL xylene were added followed by incubation at 55°C overnight. This step was repeated twice. The xylene was removed by centrifugation at 13,000 x g for 10 minutes and 350 µL ethanol were added followed by incubation at 37°C for 1 hour. The ethanol was removed by centrifugation at 13,000 x g for 10 minutes. This step also was repeated twice. The treated samples were desiccated for 20 minutes, suspended in proteinase K buffer [1 mol/L Tris (pH 8.0-8.5), 0.5 mmol/L EDTA, 0.5% Tween 20], and subjected to incubation at 55°C overnight. Finally, the samples were heat treated at 95°C for 5 minutes and stored at 4°C.
PCR of the mtDNA D-Loop Region
The D-loop DNAs derived from the cell lines were amplified by PCR. PCR was done in the final volume of 50 µL with primers of F15971 (TTAACTCCACCATTAGCACC) and R594 (GAGGTAAGCTACATAAACTG). PCR conditions were as follows: 1 cycle of 96°C for 1 minute followed by 32 cycles of 15 seconds at 94°C, 30 seconds at 56°C, and 20 seconds at 72°C, ending with a final extension of 5 minutes at 72°C (model 9600, Perkin-Elmer, Wellesley, MA). The PCR products were purified with the QIAquick PCR purification kit (Qiagen). These products are free of nuclear pseudogenes, as pointed out previously, because this set of primers is specific for the D-loop DNA.
The D-loop DNAs derived from tumor tissues were prepared by nested PCR with the inner primers of F16031 (ATGGGGAAGCAGATTTGGGTAC) and R567 (TGAGATTAGTAGTATGGGAG). The PCR conditions were the same as those used to prepare the tumor cell lines.
Cloning and Sequencing of the mtDNA D-Loop Region
The mixed PCR products derived from three independent amplifications were cloned into the TOPO TA-PCR cloning vector (Invitrogen, Carlsbad, CA). The cloned D-loop DNAs were sequenced with the ALF express II TM DNA sequencer (version 2.1, Amersham Pharmacia Biotech, Inc., Piscataway, NJ) using the Thermo Sequence CyTM5 Dye Terminator kit (Amersham Pharmacia Biotech). Thermal cycling was done in the Perkin-Elmer model 9600 and the PCR conditions were as follows. First, one cycle for 1 minute at 96°C followed by 30 cycles of 30 seconds at 96°C, 10 seconds at 50°C, and 120 seconds at 60°C. The PCR products were purified by an Auto SeqTM G-50 spin column (Amersham Pharmacia Biotech) before sequencing. Polyacrylamide gel of the ReproGel Set (Amersham Pharmacia Biotech) was used for electrophoresis.
Received August 12, 2004;
revised November 15, 2004;
accepted November 29, 2004.
 |
References
|
|---|
- Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981;290:45765.[CrossRef][Medline]
- Walberg MW, Clayton DA. Sequence and properties of the human KB cell and mouse L cell D-loop regions of mitochondrial DNA. Nucleic Acids Res 1981;9:541121.[Abstract/Free Full Text]
- Chang DD, Clayton DA. Priming of human mitochondrial DNA replication occurs at the light-strand promoter. Proc Natl Acad Sci U S A 1985;82:3515.[Abstract/Free Full Text]
- Chang DD, Clayton DA. Precise identification of individual promoters for transcription of each strand of human mitochondrial DNA. Cell 1984;36:63543.[CrossRef][Medline]
- Bogenhagen D, Clayton DA. The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells. J Biol Chem 1974;249:79915.[Abstract/Free Full Text]
- Wallace DC, Schoffner JM, Trounce I, et al. Mitochondrial DNA mutations in human degenerative diseases and aging. Biochim Biophys Acta 1995;1271:14151.[Medline]
- Yakes FM, Van Houten B. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci U S A 1997;94:5149.[Abstract/Free Full Text]
- Burgart LJ, Zheng J, Shu Q, Strickler JG, Shibata D. Somatic mitochondrial mutation in gastric tumor. Am J Pathol 1995;147:110511.[Abstract]
- Bianchi MS, Bianchi NO, Bailliet G. Mitochondrial DNA mutations in normal and tumor tissues from breast tumor patients. Cytogenet Cell Genet 1995;71:99103.[Medline]
- Polyak K, Li Y, Zhu H, et al. Somatic mutations of the mitochondrial genome in human colorectal tumors. Nat Genet 1998;20:2913.[CrossRef][Medline]
- Fliss MS, Usadel H, Caballero OL, et al. Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Science 2000;287:20179.[Abstract/Free Full Text]
- Yeh JJ, Lunetta KL, van Orsouw NJ, et al. Somatic mitochondrial DNA (mtDNA) mutations in papillary thyroid carcinomas and differential mtDNA sequence variants in cases with thyroid tumors. Oncogene 2000;19:20606.[CrossRef][Medline]
- Greenberg BD, Newbold JE, Sugino A. Intraspecific nucleotide sequence variability surrounding the origin of replication in human mitochondrial DNA. Gene 1983;21:3349.[CrossRef][Medline]
- Jazin EE, Cavelier L, Eriksson I, Oreland L, Gyllensten U. Human brain contains high levels of heteroplasmy in the noncoding regions of mitochondrial DNA. Proc Natl Acad Sci U S A 1996;93:123827.[Abstract/Free Full Text]
- Marchington DR, Hartshorne GM, Barlow D, Poulton J. Homopolymeric tract heteroplasmy in mtDNA from tissues and single oocytes: support for a genetic bottleneck. Am J Hum Genet 1997;60:40816.[Medline]
- Kunkel TA. Frameshift mutagenesis by eucaryotic DNA polymerases in vitro. J Biol Chem 1986;261:135817.[Abstract/Free Full Text]
- Wakeley J. Substitution rate variation among sites in hypervariable region 1 of human mitochondrial DNA. J Mol Evol 1993;37:61323.[Medline]
- Brown MD, Hosseini SH, Torroni A, et al. mtDNA haplogroup x: an ancient link between Europe/Western Asia and northern America? Am J Hum Genet 1998;63:185261.
- Nekhaeva E, Bodyak ND, Kraytsberg Y, et al. Clonally expanded mtDNA point mutations are abundant in individual cells of human tissues. Proc Natl Acad Sci U S A 2002;99:55216.[Abstract/Free Full Text]
- Attardi G, Yoneda M, Chomyn A. Complementation and segregation behavior of disease-causing mitochondrial DNA mutations in cellular model systems. Biochim Biophys Acta 1995;1271:2418.[Medline]
- Moraes CT, Schon EA. Detection and analysis of mitochondrial DNA and RNA in muscle by in situ hybridization and single fiber PCR. Methods Enzymol 1996;264:52240.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
D.C. WALLACE
Mitochondria and Cancer: Warburg Addressed
Cold Spring Harb Symp Quant Biol,
January 1, 2005;
70(0):
363 - 374.
[Abstract]
[PDF]
|
 |
|