Molecular Cancer Research Holland CR Podcast
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, J.
Right arrow Articles by Colburn, N. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, J.
Right arrow Articles by Colburn, N. H.
Molecular Cancer Research 3:100-109 (2005)
© 2005 American Association for Cancer Research


Signaling and Regulation

Histone Deacetylase Inhibition Down-Regulates Cyclin D1 Transcription by Inhibiting Nuclear Factor-{kappa}B/p65 DNA Binding

Jing Hu and Nancy H. Colburn

Gene Regulation Section, Laboratory of Cancer Prevention, Center for Cancer Research, National Cancer Institute-Frederick, Frederick, Maryland

Requests for reprints: Jing Hu, Gene Regulation Section, Laboratory of Cancer Prevention, Center for Cancer Research, National Cancer Institute-Frederick, Building 567, Room 188, Frederick, MD 21702. Phone: 301-846-6216; Fax: 301-846-6907. E-mail: huji{at}ncifcrf.gov


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Histone deacetylase (HDAC) inhibitors are emerging as a promising new class of cancer therapeutic agents. HDAC inhibitors relieve the deacetylation of histone proteins. However, little is known about the nonhistone targets of HDAC inhibitors and their roles in gene regulation. In this study, we addressed the molecular basis of the down-regulation of the nuclear factor-{kappa}B (NF-{kappa}B)–responsive gene cyclin D1 by the HDAC inhibitor trichostatin A in mouse JB6 cells. Cyclin D1 plays a critical role in cell proliferation and tumor progression. Trichostatin A inhibits cyclin D1 expression in a NF-{kappa}B-dependent manner in JB6 cells. Electrophoretic mobility shift assay studies showed that trichostatin A treatment prevents p65 dimer binding to NF-{kappa}B sites on DNA. Moreover, a chromatin immunoprecipitation assay shows that trichostatin A treatment inhibits endogenous cyclin D1 gene transcription by preventing p65 binding to the cyclin D1 promoter. However, acetylation of p65 is not affected by trichostatin A treatment. Instead, trichostatin A enhances p52 acetylation and increases p52 protein level by enhancing p100 processing. This is the first report that trichostatin A, a HDAC inhibitor, activates p100 processing and relieves the repression of p52 acetylation. The enhanced acetylation of p52 in the nuclei may operate to cause nuclear retention of p65 by increasing the p52/p65 interaction and preventing I{kappa}B{alpha}-p65 binding. The enhanced p52 acetylation coincides with decreased p65 DNA binding, suggesting a potential role of p52 acetylation in NF-{kappa}B regulation. Together, the results provide the first demonstration that HDAC inhibitor trichostatin A inhibits cyclin D1 gene transcription through targeting transcription factor NF-{kappa}B/p65 DNA binding. NF-{kappa}B is therefore identified as a transcription factor target of trichostatin A treatment.

Key Words: cyclin D1 • trichostatin A • NF-{kappa}B • protein processing • acetylation


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Histone deacetylase (HDAC) inhibitors suppress cell proliferation and induce tumor cell growth arrest and apoptosis (1, 2). They selectively affect transcription of a small portion of the genes, including cell cycle regulators, such as p21WAF1/CIP1, and exert potent antitumor effects both in vivo and in vitro (3-5). However, with the exception of the hyperacetylation of histone proteins, little is known of the molecular basis of HDAC inhibitor target gene regulation and of the nonhistone acetylation targets (6).

The transcription factor nuclear factor-{kappa}B (NF-{kappa}B) consists of two groups of NF-{kappa}B members. The first group consisting of Rel proteins [RelA (also known as p65), RelB, and c-Rel] is synthesized in the mature form. The second group consisting of NF-{kappa}B1 (p105) and NF-{kappa}B2 (p100) is processed to produce the mature p50 and p52 proteins, respectively (7). These two groups dimerize to form heterodimers or homodimers that bind to a common sequence motif known as the {kappa}B site. Among these dimers, RelA/p65-containing complexes are responsible for most of the transcriptional activity of NF-{kappa}B in many models.

Two major NF-{kappa}B regulation pathways have been proposed. In resting cells, NF-{kappa}B dimers are held captive in the cytoplasm by specific inhibitory I{kappa}B proteins (I{kappa}B{alpha}, I{kappa}Bß, I{kappa}B{varepsilon}, p105, and p100). Activation of NF-{kappa}B is triggered by stimuli, such as tumor necrosis factor-{alpha} (TNF-{alpha}), which activates the I{kappa}B kinase (IKK) complex (8, 9). Activated IKK then phosphorylates NF-{kappa}B-bound I{kappa}B, and this targets I{kappa}B for ubiquitin-dependent degradation, allowing the liberated NF-{kappa}B dimers to translocate to the nucleus to activate NF-{kappa}B-responsive genes (10-12).

Proteolytic processing of p105 and p100 is another important pathway of NF-{kappa}B regulation. The processing of p105 is largely a constitutive event (13, 14). In contrast to the high abundance of p50 in most cell types, the processing of p100 yields p52 in low abundance (15). The production of p52 is tightly controlled and highly selective and plays an important role in NF-{kappa}B activation (16, 17). Certain cytokines selectively activate the catalytic subunit (IKK{alpha}) and, along with another protein kinase called NF-{kappa}B-inducible kinase, trigger this processing-dependent pathway. Together, IKK{alpha} and NF-{kappa}B-inducible kinase induce the phosphorylation-dependent proteolytic removal of the I{kappa}B-like COOH-terminal domain of p100. This allows dimers containing p52 to translocate to the nucleus (18, 19).

Post-translational modifications of NF-{kappa}B proteins are yet another level of NF-{kappa}B regulation. Like p65 phosphorylation (20), p65 acetylation is also important for NF-{kappa}B activation. Whether acetylation of p65 activates or suppresses NF-{kappa}B target gene transcription seems to depend on the biological context of the cell and the discrete acetylation sites of the NF-{kappa}B subunits (21, 22). Acetylation of p65 at Lys218, Lys221, and Lys310 activates NF-{kappa}B by inhibiting I{kappa}B{alpha} binding to p65 and preventing the nuclear export of the NF-{kappa}B complex. Acetylation of p65 at Lys122 and Lys123 suppresses NF-{kappa}B-dependent gene transcription by reducing its binding to {kappa}B-containing DNA, facilitating its removal by I{kappa}B{alpha} and subsequent export to the cytoplasm (23).

In addition to acetylation of p65, acetylation of NF-{kappa}B p50 can be regulated (24). Acetylation of p50 increases its DNA binding and further enhances NF-{kappa}B transcriptional activity. Enhanced p50 acetylation correlates with increased p50 binding to cyclooxygenase-2 promoter and transcriptional activation (25).

NF-{kappa}B activation induces a variety of genes that are involved in cell proliferation and cell survival, including cyclin D1 (7, 26). The HDAC inhibitors interrupt cell cycle progression in G1 and G2-M phase, resulting in growth arrest through induction of p21WAF1/CIP1 and suppression of cyclin D1 expression (27-29). The HDAC inhibitor-induced p21WAF1/CIP1 expression is mediated by Sp1 (28), whereas the molecular mechanism of the suppression of cyclin D1 is largely unknown. In this report, we show that down-regulation of cyclin D1 mRNA and protein by HDAC inhibitor trichostatin A in mouse JB6 cells is due to the lack of p65 binding to the cyclin D1 promoter. Although acetylation of p65 is unaffected by trichostatin A, trichostatin A activates p100 processing and selectively enhances acetylation of p52. Hyperacetylation of p52 coincides with diminished p65 DNA binding, suggesting a potential role of p52 acetylation in the regulation of NF-{kappa}B and NF-{kappa}B-controlled gene expression.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Trichostatin A Treatment Suppresses Cyclin D1 Transcriptional Activation
HDAC inhibitors stimulate the expression of growth-inhibitory genes, such as p21Waf and p27Kip1, and suppress the proliferation of cancer cells (4). Expression of cyclin D1, a positive cell cycle regulator that plays a critical role in tumor development (30, 31), is inhibited by HDAC inhibitors (27). In this study, we tested whether and how trichostatin A suppresses cyclin D1 expression. As shown in Fig. 1A, trichostatin A exposure suppressed cyclin D1 protein expression. Positive controls TNF-{alpha} and 12-O-tetradecanoylphorbol-13-acetate (TPA) are shown to enhance cyclin D1 expression. Coexposure of trichostatin A and TNF-{alpha} down-regulated cyclin D1 protein expression, indicating that trichostatin A overrides the inducing effect of TNF-{alpha} on cyclin D1 gene expression. We next examined whether the down-regulation of cyclin D1 occurs at a pretranslational level. Northern blotting results (Fig. 1B) show that cyclin D1 mRNA expression is suppressed by trichostatin A treatment in JB6 cells. Again, trichostatin A also abolished TNF-{alpha}-induced cyclin D1 mRNA expression. Assay of transfected cyclin D1 promoter reporter activity suggests that trichostatin A completely inhibits TNF-{alpha}-induced transcription from the cyclin D1 promoter (Fig. 1C). In contrast to the dramatic trichostatin A suppression of endogenous basal cyclin D1 mRNA expression (Fig. 1B), basal transcription from the transfected cyclin D1 promoter showed little or no inhibition by trichostatin A (Fig. 1C). This may suggest that, whereas trichostatin A inhibition of endogenous TNF-{alpha}-induced expression is transcriptional, trichostatin A inhibition of endogenous basal expression (Fig. 1B) is not transcriptional. Alternatively, the cyclin D1 promoter may resemble that of metallothionein (32) in containing separate elements for regulating induced and basal transcription. The partial cyclin D1 promoter sequence (–66) used in the transfection experiment may contain elements needed to regulate induced transcription but may lack one or more elements needed to regulate basal transcription. Another possibility is that a transfected promoter is not functioning in a chromatin context and consequently does not recapitulate all of the regulation (in this case, basal regulation) that is seen with endogenous genes (33). In summary, trichostatin A inhibits TNF-{alpha}-induced and basal expression of endogenous cyclin D1. Observations with a transfected cyclin D1 promoter suggest that the regulation of TNF-{alpha}-induced but not basal cyclin D1 expression is transcriptional.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 1. Trichostatin A (TSA) inhibits cyclin D1 mRNA expression and cell proliferation. A. Trichostatin A down-regulates cyclin D1 protein expression. JB6 cells were treated with trichostatin A 10 ng/mL (33 nmol/L), TPA (10 ng/mL), and/or TNF-{alpha} (10 ng/mL) for the indicated time. Cells were harvested and whole cell lysates were used for immunoblotting. B. Trichostatin A reduces cyclin D1 RNA expression. Total RNA was isolated and cyclin D1 RNA level was examined by Northern blotting. C. Derepressed acetylation blocks TNF-{alpha}-induced transactivation of cyclin D1 promoter. The –66 cyclin D1 promoter firefly luciferase reporter construct was used for the promoter activity assay. Columns, mean of three to five independent experiments; bars, SD. *, P < 0.05, significant difference from the promoter activity in control cells. {clubsuit}, P < 0.05, significant difference from the promoter activity in TNF-{alpha}-treated cells. D. Trichostatin A inhibits JB6 cell proliferation by arresting cells in G0-G1 phase. For cell proliferation assay, JB6 cells were plated at 1 x 105 cells onto six-well cell culture plate. On the next day, DMSO and trichostatin A 10 ng/mL (33 nmol/L) were added directly to the cell culture medium. Cells were counted at the indicated time. For cell cycle analysis, JB6 cells were treated with trichostatin A for 48 hours. Cellular DNA content was measured by flow cytometric analysis after treatment with trichostatin A for 48 hours. It is noteworthy that trichostatin A at this concentration does not cause cell death in the JB6 cells. Points, mean of three independent experiments; bars, SD of cell number (graph) or percentage of cells in cell cycle phase (table). *, P < 0.05, significant difference from respective values in control cells.

 
As cyclin D1 is considered to be a positive cell cycle regulator, we predicted that trichostatin A treatment would cause cell growth inhibition. Results from Fig. 1D show that trichostatin A indeed inhibits JB6 cell proliferation. It is noteworthy that cytotoxicity does not contribute to the inhibition of cell growth because the cell numbers do not decrease after trichostatin A treatment. Tumor promoters, such as TPA, remarkably induce mitogenic stimulation at plateau density but produce little or no enhancement of logarithmic growth rate (34). In the current study, the JB6 cells were harvested before reaching plateau density. In these logarithmically growing cells cultured in serum (4% fetal bovine serum)–containing medium, TPA or TNF-{alpha} induces cell proliferation slightly over the baseline. Trichostatin A, however, abrogates both TPA-induced and TNF-{alpha}-induced cell growth (data not shown). Finally, because cyclin D1 serves as a key regulator of G1-S transition (26), we examined whether treatment with trichostatin A would arrest cells in G1/G0 phase. As is shown in Fig. 1D, the percentage of cells that were undergoing or had just completed DNA replication (S and G2-M phases) was 69% in control cells and 41% in trichostatin A–treated cells, with a concomitant increase in the percentage of G0-G1 population of cells from 31% to 59%. These findings show that trichostatin A inhibits JB6 cell proliferation by causing an accumulation of cells with a G1 content of DNA. The results thus provide evidence to link suppressed cyclin D1 expression to cell growth inhibition, suggesting that trichostatin A down-regulated cyclin D1 is functionally significant.

Inhibition of p65 Binding to Cyclin D1 Promoter Contributes to Down-Regulation of Gene Transcription
Because the –66 cyclin D1 promoter contains a consensus NF-{kappa}B binding site and lacks other sites, and cyclin D1 is a well-known NF-{kappa}B-responsive gene (26), the results in Fig. 1 therefore suggest a link between NF-{kappa}B and trichostatin A–induced down-regulation of cyclin D1 gene transcription. To test whether the inhibition of NF-{kappa}B DNA binding may contribute to the suppression of cyclin D1 gene expression, we did a gel mobility shift assay using oligonucleotides containing the NF-{kappa}B consensus sequence. According to previous reports (35) in JB6 cells and as shown by supershift results (Fig. 2A), the lower bands (Fig. 2A, band 1) are p50- and p52-containing complexes, whereas the upper bands (Fig. 2A, bands 2 and 3) are the p65-containing complexes. The observation that antibody against p65 completely shifts bands 2 and 3 up in the supershift assay indicates that both bands contain p65 in all complexes. As expected, TNF-{alpha} treatment stimulated p65-containing complex binding to DNA, represented by increased intensity of bands 2 and 3 on a mobility shift gel. In agreement with a previous report (36), trichostatin A treatment did not cause alteration in DNA binding of specificity control POU domain Oct-1 protein, a NF-{kappa}B-unrelated transcription factor. Trichostatin A specifically prevented TNF-{alpha}-induced p65 DNA binding. This is consistent with the observation (Fig. 1) that trichostatin A overrides the effect of TNF-{alpha} on cyclin D1 gene expression. Trichostatin A thus inhibits in vitro DNA binding of activated NF-{kappa}B complexes containing p65.



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 2. Trichostatin A inhibits binding of p65 to the cyclin D1 promoter. A. Trichostatin A inhibits binding to DNA of TNF-{alpha}-induced p65 containing complex. JB6 cells were collected after 24-hour trichostatin A 100 ng/mL (330 nmol/L) treatment and/or 1-hour TNF-{alpha} (10 ng/mL) treatment. Nuclear extract (1 mg) was used for the electrophoretic mobility shift assay. Antibodies against individual NF-{kappa}B proteins (p65, p50, or p52) were used to characterize the components of the complex. The supershift (with anti-p65) result and blocked shift (with anti-p50 and anti-p52) results (middle) show that p65, p50, and p52 are the major NF-{kappa}B proteins in the complex. DNA binding of the POU domain protein transcription factor Oct-1 is not affected by trichostatin A treatment. B. Lack of p65 binding to cyclin D1 promoter occurs also with the endogenous promoter. JB6 cells were treated with trichostatin A 100 ng/mL (330 nmol/L) and/or TNF-{alpha} for indicated time. Chromatin immunoprecipitation (ChIP) was done with a chromatin immunoprecipitation assay kit, and all the experimental procedures were carried out according to the protocol provided. Relative intensities of the bands measured by densitometry are labeled beneath each band.

 
To determine whether trichostatin A treatment affects p65 binding to the endogenous gene promoter, we used a chromatin immunoprecipitation assay to analyze the binding of p65 to the cyclin D1 promoter. Following formaldehyde cross-linking, PCR amplification of DNA present in the anti-p65 chromatin immunoprecipitation precipitate showed that trichostatin A treatment did inhibit p65 binding to cyclin D1 promoter DNA (Fig. 2B), the relative intensities of the bands decreased from 10 to 0 (comparing the basal and trichostatin A treated) and from 14 to 2.5 (comparing TNF-{alpha} alone and with trichostatin A). Therefore, both in the presence and in the absence of TNF-{alpha}, trichostatin A treatment prevented p65 binding to cyclin D1 promoter DNA. This suggests that trichostatin A acts to suppress transcription of endogenous cyclin D1. The specificity of these analyses was confirmed in control chromatin immunoprecipitation assay examining p65 recruitment to the Bcl-xL promoter. c-Rel and p65 bind to Bcl-xL promoter and directly activate Bcl-xL gene transcription (37, 38). In JB6 cells, trichostatin A treatment did not result in a change in cellular Bcl-xL level (data not shown). Consistent with that observation, amplification of the anti-p65 chromatin immunoprecipitation precipitate showed that p65 binding to Bcl-xL promoter was unaffected by trichostatin A. These results indicate the specificity and selectivity of trichostatin A on a NF-{kappa}B-controlled target gene. Although trichostatin A inhibited p65 DNA binding by chromatin immunoprecipitation assay, binding of p65 to Bcl-xL promoter DNA was not decreased in the chromatin immunoprecipitation assay. This may reflect chromatin remodeling activities specific to each promoter or may suggest differing requirements for non-NF-{kappa}B transcription factors or cofactors. In addition, the selectivity for the target gene is largely dependent on specific stimuli and biological context. Together, the chromatin immunoprecipitation results extend to the endogenous cyclin D1 gene promoter the observations made with electrophoretic mobility shift assay analysis and with transfection of the cyclin D1 promoter reporter. Derepression of acetylation by trichostatin A down-regulates transcription from the cyclin D1 promoter.

Trichostatin A Treatment Relieves the Deacetylation of p52 but not of p65 or p50
Results in Fig. 1 suggest that NF-{kappa}B is a transcription factor that is targeted by the HDAC inhibitor. We hypothesized that trichostatin A may target NF-{kappa}B by affecting NF-{kappa}B acetylation. We then asked which NF-{kappa}B protein is an acetylation derepression target of trichostatin A. Given the fact that trichostatin A enhances TNF-{alpha}-induced p65 acetylation (21) and that p65 is the only Rel family member in mouse JB6 cells (35), it appeared that p65 might be the most likely acetylation derepression candidate. To ascertain whether trichostatin A enhances p65 acetylation, we did immunoprecipitation with p65 antibody to precipitate the p65 complex containing p65- and p65-associated proteins. Because we lacked a specific antibody that recognizes acetylated p65, the antibody against acetylated lysine was used to detect any acetylated protein that is associated with p65, and we established in our previous report that the acetylated band at 64 kDa is acetylated p65 (39). As is shown in Fig. 3A, the overall p65 acetylation level was low. Surprisingly, strong bands representing heavy acetylation were found ~51 kDa but not at 65 kDa (Fig. 3A). This result indicates that acetylation of p65 is unaffected by trichostatin A in JB6 cells and that protein(s) associated with p65 rather p65 itself are strongly acetylated on trichostatin A treatment. Because the acetylated bands appear to be ~53 kDa, we tested whether the strong acetylation signal associated with the p65 complex represented acetylated p53. p53 is acetylated and its acetylation status is affected by HDAC inhibitor treatment (40, 41). Although trichostatin A treatment did enhance p53 acetylation at Lys373 and Lys382 (data not shown), coimmunoprecipitation did not detect p65-associated p53 (data not shown). This result excluded the possibility that p53 is the acetylated protein associated with p65. Therefore, it seems that two NF-{kappa}B proteins, p52 and p50, were the most likely candidates targeted by trichostatin A–inhibited deacetylation. To identify the acetylation target, a filter was stripped and reprobed with acetylated lysine antibody together with a p50 antibody that recognizes both p50 and its precursor p105. As is shown in Fig. 3A, the acetylated protein band is separated from the p50 band, and the molecular weight of the protein is greater than p50. To further confirm that p50 was not the target of inhibited deacetylation, we probed a fresh immunoprecipitation blot (no stripping) with anti-p50. The p65-bound p50 was slightly decreased by trichostatin A treatment. Therefore, it seems that p50 is not the trichostatin A target. We then examined whether p52 acetylation is regulated by trichostatin A treatment. As shown in Fig. 3B, the p52 band coincided with the acetylated band. In contrast to the slight decrease in the p65-bound p50 following trichostatin A treatment (Fig. 3A), the p65-bound p52 is remarkably enhanced (Fig. 3B). Therefore, p52, not p50 or p65, is a target of the trichostatin A–increased NF-{kappa}B acetylation in JB6 cells.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 3. Trichostatin A treatment regulates acetylation of p52 but not p65 or p50. A. Trichostatin A treatment does not affect p50 or p65 acetylation. JB6 cells were collected after 24-hour trichostatin A 100 ng/mL (330 nmol/L) treatment and/or 1-hour TNF-{alpha} (10 ng/mL) treatment. Cell lysates were subjected to immunoprecipitation with antibody against p65 followed by immunoblotting with antiacetylated lysine and/or anti-p50 that also recognizes p105. According to our previous findings (39), the upper acetylated band at 64 kDa represents acetylated p65. B. Trichostatin A treatment results in hyperacetylation of p65-bound p52. Cell lysates were immunoprecipitated with anti-p52, the filter was blotted with antibody against acetylated lysine, and the identical blot was stripped and reblotted with anti-p52 (also recognizes p100).

 
Trichostatin A Treatment Activates p100 Processing to p52
Figure 3 shows that p65 binding of p52 is dramatically enhanced on trichostatin A treatment, suggesting that the cellular level of p52 is increased. The increase in p52 product may result from trichostatin A–induced p100 processing to p52. As shown in Fig. 4A and B, trichostatin A did enhance p52 acetylation and p100 processing in a dose- and time-dependent manner in JB6 cells. Although the mechanism is not known, Northern blotting analysis indicates that p100 mRNA expression is induced by trichostatin A in a time-dependent manner (Fig. 4C). The increased p100 mRNA expression and the decreased p100 protein level is consistent with the induction by trichostatin A treatment of the turnover of p100 to p52. Of note, the increases in p52 acetylation and p100 processing seemed to occur simultaneously with an onset ~1 to 3 hours (Fig. 4B), suggesting that trichostatin A–caused relief of deacetylation of p52 occurs rapidly after p52 is produced from p100. As nonacetylated p52 is clearly detected in the control JB6 cells, it seems that both trichostatin A–inhibited deacetylation and trichostatin A–increased p52 levels contribute to the accumulation of acetylated p52. Together, the results show that trichostatin A treatment promotes p100 processing to p52. Targeting p100 processing and p52 acetylation might contribute to the mechanism by which trichostatin A inhibits NF-{kappa}B activation.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 4. Trichostatin A treatment coordinately alters p100 processing and p52 acetylation. A. Dose curve of 24-hour trichostatin A treatment on p52 acetylation. JB6 cells were treated with trichostatin A 100 ng/mL (330 nmol/L) for 24 hours and whole cell lysates were used for immunoprecipitation with anti-p52. Acetylated p52 was detected with antibody against acetylated lysine. p100 and p52 were detected with antibody against p52. B. Time course of trichostatin A on p52 acetylation. JB6 cells were treated with trichostatin A 100 ng/mL for the indicated time. Whole cell lysates were used for the assay. C. Trichostatin A induces p100 mRNA expression. JB6 cells were pretreated with 10 mg/mL actinomycin D for 1 hour and then incubated with the 100 ng/mL (330 nmol/L) of trichostatin A for 6 or 24 hours. RNA (20 mg) from each sample was used for Northern blotting analysis.

 
Trichostatin A Induces p65 Nuclear Retention
We next attempted to explore the molecular basis of the inhibition of p65 DNA binding on trichostatin A exposure. Because both p65 acetylation (Fig. 3A) and p65 protein level (Fig. 5B) were unaffected by trichostatin A treatment (Fig. 3A), we asked whether the diminished p65 DNA binding is due to inhibited p65 nuclear translocation. Surprisingly, Western analysis showed that not only TNF-{alpha} but also trichostatin A induces p65 nuclear accumulation (Fig. 5A). This occurs specifically without affecting nuclear proliferating cell nuclear antigen level.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIGURE 5. Derepressed acetylation leads to nuclear retention of p65 in a complex with acetylated p52. A. Nuclear retention of p65 by trichostatin A treatment. JB6 cells were treated with trichostatin A 100 ng/mL (330 nmol/L) and/or TNF-{alpha} (10 ng/mL) as indicated time. Nuclear (NE) and cytoplasmic (Cyto) extraction of the cellular protein was used for immunoblotting. B. Trichostatin A reduces I{kappa}B{alpha}-p65 complex. Whole cell lysates were used for immunoprecipitation with anti-p65. Total cellular I{kappa}B{alpha} level was evaluated with immunoblotting. C. Nuclear localization of acetylated p52. Nuclear and cytoplasmic extraction of the cellular protein was used for immunoprecipitation with anti-p52. Acetylated p52 was detected with antiacetylated lysine. p52 associated p65 was detected with anti-p65.

 
Because TNF-{alpha} stimulates p65 nuclear translocation by promoting I{kappa}B{alpha} degradation, we determined the association of p65 and I{kappa}B{alpha} in the presence of trichostatin A and/or TNF-{alpha}. Treatment with TNF-{alpha} induces rapid degradation of I{kappa}B{alpha}. NF-{kappa}B-dependent resynthesis of I{kappa}B{alpha} begins ~30 minutes after TNF-{alpha} treatment in JB6 cells (data not shown; refs. 35, 42). As expected, 30-minute treatment with TNF-{alpha} decreased the amount of p65/I{kappa}B{alpha} complex (Fig. 5B). Trichostatin A alone or with TNF-{alpha} also reduced the p65/I{kappa}B{alpha} complex. This can be explained by trichostatin A–decreased cellular I{kappa}B{alpha} level, which is controlled by NF-{kappa}B activity (8). Together, the decrease of I{kappa}B{alpha} protein by trichostatin A treatment suggests that I{kappa}B{alpha}-mediated p65 nuclear export is inhibited and this may contribute to the nuclear retention of p65.

It is noteworthy that trichostatin A–induced p65 nuclear retention coincides with trichostatin A–induced p52 acetylation and p65/p52 association (Fig. 3). This observation led us to test whether acetylated p52 is localized in the nucleus. Results in Fig. 5C show that, whereas nonacetylated p52 is detected in the cytosol, acetylated p52 was detected only in the nucleus, indicating that acetylation of p52 occurs in the nucleus and acetylated p52 remains in the nucleus (Fig. 5C). As expected, p52-associated p65 increased remarkably in the nucleus on trichostatin A treatment. Therefore, acetylation of p52 seems to contribute to the nuclear retention of p65 by trapping acetylated p52/p65 complexes in the nucleus. Together, the results indicate that trichostatin A–inhibited NF-{kappa}B DNA binding does not result from inhibited p65 nuclear translocation. Rather, trichostatin A treatment induces p65 nuclear retention that in turn arises from inhibited I{kappa}B{alpha}-mediated p65 nuclear export and/or increased nuclear levels of acetylated p52.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
This study shows that the HDAC inhibitor trichostatin A suppresses cyclin D1 expression by inhibiting p65 binding to the cyclin D1 promoter. NF-{kappa}B protein p52, but not p65 or p50, is identified as a nonhistone acetylation target of trichostatin A treatment. Trichostatin A also increases cellular p52 level by promoting p100 processing to p52. This stimulated processing contributes in part to the enhanced p52 acetylation. NF-{kappa}B seems to be an important transcription factor target of trichostatin A treatment. The results suggest that trichostatin A–enhanced p100 processing and p52 acetylation play a significant role in the regulation of NF-{kappa}B and NF-{kappa}B-dependent cyclin D1 gene expression on trichostatin A treatment. These findings suggest a novel mechanism by which trichostatin A inhibits cell proliferation.

Inhibition of HDAC activity by HDAC inhibitors results in the accumulation of acetylated histones. Although histone acetylation is significantly enhanced, HDAC inhibitors affect the expression of only a small set (4-12%) of genes (43). One possible explanation for the gene selectivity is that regulation of certain transcription factors, such as NF-{kappa}B, by HDAC inhibitor treatment contributes to the specificity and the selectivity of target gene regulation. In this study, we showed that trichostatin A down-regulates cyclin D1 gene transcription by targeting NF-{kappa}B. Short-term treatment with trichostatin A (1-2 hours) enhances TNF-{alpha}-induced NF-{kappa}B activity (21, 44). However, microarray and other approaches have shown that long-term treatment (≥24 hours) with HDAC inhibitors, including trichostatin A, down-regulates NF-{kappa}B (45-47). Considering the fact that HDAC inhibitors are promising antitumor agents, the long-term effects of trichostatin A may have more clinical relevance. Therefore, the molecular basis of down-regulation of NF-{kappa}B by trichostatin A might have physiologic and clinical implications. In agreement with previous findings that the HDAC inhibitors sodium butyrate and suberoylanilide hydroxamic acid reduce DNA binding of NF-{kappa}B in vitro (46, 47), our results extend this observation to show that the 24-hour trichostatin A treatment prevents p65 binding to cyclin D1 promoter in vivo. Inhibition of p65 DNA binding is expected to inhibit transcription dependent on p65. The fact that basal transcription from transfected –66 nucleotide promoter was not inhibited seems to reflect missing sites or nonchromatin context of the plasmid rather than a nontranscriptional mechanism by which basal endogenous transcription is inhibited. Trichostatin A inhibits both basal and TNF-{alpha}-induced transcription of endogenous cyclin D1.

It is interesting to note that the diminished p65 DNA binding is not due to reduced p65 nuclear accumulation. In fact, trichostatin A treatment increased p65 nuclear retention. The reduced I{kappa}B{alpha}-mediated nuclear export and increased p52 acetylation both contribute to trichostatin A–induced p65 nuclear retention. Why does nuclear p65 fail to bind to DNA? Our results suggest that p52 acetylation and the formation of acetylated p52 complexes with p65 may play important roles in this regulation. This seems to be the first demonstration that p52 is acetylated in vivo and that its acetylation status is targeted by trichostatin A. Because increases in p52 levels resulting from induced p100 processing are generally associated with activation of NF-{kappa}B (16, 17), it may be acetylation rather than synthesis of p52 that is responsible for the down-regulation of NF-{kappa}B activation. At present, the acetylation site on p52 is unknown and is under investigation. The observation that trichostatin A–enhanced p52 acetylation coincides with the inhibition of p65 DNA binding leads us to propose that acetylation of p52 may reduce p65 DNA binding activity. The finding that no change in p65 protein level or acetylation state is seen on trichostatin A treatment further supports this hypothesis. It is also possible that trichostatin A treatment may produce changes in other DNA binding proteins that contribute to the inhibition of p65 DNA binding.

It seems that both trichostatin A–induced p52 level and trichostatin A–repressed deacetylation of p52 contribute to the enhanced p52 acetylation. It is interesting that trichostatin A, a HDAC inhibitor, increases the cellular p52 level by promoting p100 processing to p52. Although we cannot rule out the possibilities that acetylation stabilizes p52 protein or that trichostatin A induces cotranslational expression of p52 (48), induced p100 processing to p52 is undoubtedly the major mechanism by which trichostatin A increases the p52 level. Unlike the situation in which cytokine-induced p100 processing leads to NF-{kappa}B activation (16, 49), trichostatin A–induced p100 processing correlates with NF-{kappa}B inactivation. As discussed above, this down-regulation may result from enhanced p52 acetylation. The cytokine-induced p100 processing requires activation of NF-{kappa}B-inducible kinase or IKK{alpha} and subsequent phosphorylation of p100 COOH terminus (18). Trichostatin A, on the other hand, does not activate either NF-{kappa}B-inducible kinase or IKK{alpha} in JB6 cells (data not shown), suggesting that trichostatin A may regulate p100 processing through a different mechanism.

Although this report focuses on cyclin D1 gene regulation by trichostatin A in mouse JB6 cells, trichostatin A may target different NF-{kappa}B-responsive genes in other biological systems. It is reasonable to propose that decreased p65 DNA binding by trichostatin A might be a general mechanism of inhibition of NF-{kappa}B target genes. In fact, trichostatin A treatment inhibits p65 DNA binding in human breast cancer MCF-7 cells and human colorectal cancer HCT116 cells (data not shown). Therefore, transcription factor NF-{kappa}B may act as a general and primary target for HDAC inhibitor therapeutic intervention. Together, these findings further show that transcription factors may be good therapeutic targets (50). Because cancer cells often show elevated NF-{kappa}B activity, these observations may help to explain the higher sensitivity of cancer cells to HDAC inhibitor–induced apoptosis and growth suppression. Our results also suggest an explanation for the observation that among the genes suppressed by HDAC inhibitors several are known NF-{kappa}B-controlled target genes, such as Bcl-xL, Bcl-2, c-myb, c-myc, IL-1, IL-6, and TNF-{alpha} (6, 43, 51, 52). Understanding the functional significance and precise mechanisms of trichostatin A down-regulated NF-{kappa}B activity may lead to the design of novel combination strategies for chemotherapeutics.

In conclusion, the results suggest that trichostatin A suppresses JB6 cell proliferation by inhibiting NF-{kappa}B-mediated cyclin D1 gene expression. The down-regulation of cyclin D1 transcription results from the lack of p65 binding to its promoter. The trichostatin A–enhanced p100 processing and p52 acetylation may contribute to the inhibition of p65 DNA binding on trichostatin A treatment.


    Materials and Methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cell Culture
Clonal variants of mouse epidermal JB6 clone 41 cells were cultured as described previously (35). In brief, JB6 cells were cultured in Eagle's MEM (BioWhittaker, Frederick, MD) supplemented with 4% fetal bovine serum, 2 mmol/L L-glutamine, and 25 mg/mL gentamicin (Life Technologies, Gaithersburg, MD). All other cell culture reagents were purchased from BioWhittaker or Life Technologies.

Cell Proliferation Assay
JB6 cells were plated at 1 x 105 cells onto six-well cell culture plate. Following an overnight incubation to allow cells to adhere, DMSO and trichostatin A 10 ng/mL (33 nmol/L) were added directly to the cell culture medium. Each condition was done in triplicate. At the indicated time, the cells were trypsinized and counted.

Cell Cycle Analysis
Whole cell propidium iodide staining and flow cytometric analysis were done to determine cellular DNA content. After 2 days of incubation with or without trichostatin A 10 ng/mL (33 nmol/L), aliquots of the cells were trypsinized, washed twice in PBS, resuspended in PBS with 2% FCS and 70% ethanol while vortexing, and left at 4°C overnight. Cells were then stained at room temperature for 1 hour in 50 µg/mL propidium iodide and 100 Kunitz units/mL RNase A in PBS. The stained cells were measured by fluorescence-activated cell sorter analysis (FACScan, Becton Dickinson, Franklin Lakes, NJ) to assess DNA state.

Transient Transfection and Luciferase Assay
The –66 cyclin D1 promoter firefly luciferase reporter construct and the mutant reporter plasmid (NF-{kappa}B site at –39 to –30 bp was mutated from 5'-GGGGAGTTTT-3' to 5'-GcccAGTTTT-3') were kind gifts of Dr. Richard Pestell (Georgetown University, Washington, DC). JB6 cells were seeded at a concentration of 1 x 104 cells per well in a 24-well plate the day before transfection. Transfections were done according to the LipofectAMINE protocol (Life Technologies). After incubation with DNA in complete medium for 24 hours, cells were exposed to trichostatin A 100 ng/mL (330 nmol/L) or TNF-{alpha} (10 ng/mL) or TPA (10 ng/mL) for certain periods as indicated in the figure legends. For the combination treatment, JB6 cells were treated with trichostatin A for 21 hours and then further exposed to TNF-{alpha} for another 3 hour. The treated cells were then collected and lysed. The resulting cell lysates were assayed for luciferase activity using Dual-Luciferase Assay kit (Promega, Madison, WI) and Dynex luminometer (Dynex Technologies, Chantilly, VA). Each firefly luciferase activity driven by a specific promoter was normalized to its respective Renilla luciferase activity driven by thymidine kinase promoter as a control for transfection efficiency.

Immunoprecipitation and Immunoblotting
JB6 cells were lysed in immunoprecipitation lysis buffer containing 20 mmol/L Tris (pH 7.5), 150 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1% NP40, and 10% glycerol. Protease inhibitor cocktail tablets (Roche, Penzberg, Germany) were added to immunoprecipitation lysis buffer just before use. Cell lysates were subjected to immunoprecipitation in the lysis buffer, and the precipitated proteins were analyzed by immunoblotting. The immunoblotting was done as reported previously (35). Protein was separated using NuPage 10% Bis-Tris prepacked gel (Invitrogen, Carlsbad, CA). The proteins were electrotransferred to nitrocellulose membrane (Schleicher & Schuell, Keene, NH), and membrane-bound proteins were probed with antibody and further detected by chemiluminescence according to the enhanced chemiluminescence protocol from Amersham (Arlington Heights, IL). Antibodies against acetylated lysine and I{kappa}B{alpha} were obtained from Cell Signaling Technology (Beverly, MA). Antibody against p53 (Ab-1) was obtained from Calbiochem (San Diego, CA). Anti-acetyl-p53 (Lys373 and Lys382) was purchased from Upstate (Lake Placid, NY). All other antibodies used were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Northern Blotting
For the cyclin D1 gene expression detection, JB6 cells were either exposed to trichostatin A 100 ng/mL (330 nmol/L) for 24 hours or treated with TNF-{alpha} (10 ng/mL) or TPA (10 ng/mL) for 3 hours. In trichostatin A and TNF-{alpha} combination study, JB6 cells were pretreated with trichostatin A for 21 hours and then further incubated with TNF-{alpha} for another 3 hours. For p100 mRNA detection, JB6 cells were pretreated with 10 mg/mL actinomycin D for 1 hour and then incubated with 100 ng/mL trichostatin A for 6 or 24 hours. After treatment, the JB6 cells were washed with cold PBS twice and total cellular RNA was extracted using TRIzol reagents (Invitrogen) according to the protocol provided. RNA (20 mg) from each sample was used for Northern blotting analysis. All the reagents used for RNA gel electrophoresis and transferring were purchased from Ambion (Austin, Texas), and all the experimental procedures were carried out according to the protocol provided. Probes for p100 detection was from the PstI digestion products of p100 expression vector (kind gift from Dr. Nancy Rice, National Cancer Institute-Frederick, Frederick, MD). The probe for cyclin D1 was a DNA fragment excised from cyclin D1 expression vector (Gift from Dr. Robert A. Weinberg, Whitehead Institute for Biomedical Research, Cambridge, MA). p100 and cyclin D1 probes were labeled with [32P]ATP using Random Primed DNA Labeling kit (Roche).

Chromatin Immunoprecipitation Assay
Chromatin immunoprecipitation was done with a chromatin immunoprecipitation assay kit (Upstate), and all the experimental procedures were carried out according to the protocol provided. Briefly, JB6 cells in 150 mm dishes were treated with trichostatin A 100 ng/mL (330 nmol/L) or together with TNF-{alpha} (10 ng/mL) as indicated in the figure legends. Histone was cross-linked to DNA by adding formaldehyde directly to culture medium to a final concentration of 1% and incubated for 10 minutes at 37°C. The medium was aspirated and the cells were washed twice with cold PBS followed by subsequent centrifugation of cells for 4 minutes at 2,000 rpm at 4°C. The cell pellets were resuspended in 200 mL SDS lysis buffer and incubated for 10 minutes on ice. The DNA was sheared by sonication (model W-220 sonicator, Heat Systems Ultrasonics, Inc., Farmingdale, NY) to lengths between 500 and 1,000 bp. The sonication condition was 2 pulses, 15 seconds each, at the setting 5. After DNA shearing, the samples were centrifuged for 10 minutes at 13,000 rpm at 4°C, and sonicated cell supernatant (200 mL) was added to a new 2 mL microcentrifuge tube. The cell pellet was discarded. The sonicated cell supernatant was diluted 10-fold in chromatin immunoprecipitation dilution buffer, and chromatin preparation (100 µL) was aliquoted as the input fraction. To reduce nonspecific background, we precleared the 2 mL diluted cell supernatant with 80 mL salmon sperm DNA/protein A agarose-50% slurry for 30 minutes at 4°C with agitation, pelleted agarose by brief centrifugation, and collected the supernatant fraction. We added the p65 antibody to the 2 mL supernatant fraction and incubated overnight at 4°C with rotation. We added 60 mL salmon sperm DNA/protein A agarose-50% slurry for 1 hour at 4°C with rotation to collect the antibody/histone complex, pelleted agarose by gentle centrifugation, and washed the beads with washing buffers provided in the kit. Eluates were pooled and heated at 65°C overnight to reverse the formaldehyde cross-linking. DNA fragments were purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA). Cyclin D1 and Bcl-xL-specific PCR was done using 5 µL of a 50 µL DNA extract in Tris-EDTA buffer with Hi-Fi Taq polymerase (Invitrogen). PCR mixtures were amplified for 1 cycle at 94°C for 2 minutes followed by 35 cycles at 94°C for 30 seconds, annealing temperature of 55°C for 30 seconds, and 68°C for 30 seconds and then subjected to a final elongation at 68°C for 5 minutes. The primers used for mouse cyclin D1 (5'-CCGGCTTTGATCTCTGCTTA-3' and 5'-GCTGTACTGCCGGTCTCC-3') detection amplify 150 bp of the cyclin D1 promoter surrounding the NF-{kappa}B site. The primers used for mouse Bcl-xL (5'-ACAGATCCGAGGCTGTCTTC-3' and 5'-CCCGGAGGTATGGGTTTAGT-3') detection amplify 164 bp of the Bcl-xL promoter surrounding the NF-{kappa}B site (GGGACTTCC; ref. 37).

Electrophoretic Mobility Shift Assay
Cells were collected after 24-hour trichostatin A treatment and/or 1-hour TNF-{alpha} treatment. Nuclear extracts were prepared using NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Inc., Rockford, IL). A gel shift assay system (Promega) was used for electrophoretic mobility shift assay, and all the experimental procedures were carried out according to the protocol provided. Double-stranded oligonucleotides containing NF-{kappa}B consensus sequence AGTTGAGGGGACTTTCCCAGG and transcription factor Oct-1 consensus sequence TGTCGAATGCAAATCACTAGA were purchased from Santa Cruz Biotechnology. Antibodies against p65, p50, and p50 used for supershift were obtained from Santa Cruz Biotechnology. Antibodies (1 mL each) and nuclear extract (1 mg) were used for each assay. The protein-DNA complexes were resolved on a 6% retardation gel (Invitrogen) and visualized by autoradiograph.

Statistical Appraisals
Groups of test data (means ± SD) were compared using Student's t test for unpaired observations. Statistically significant differences are denoted at P < 0.05.

Received April 19, 2005; revised December 7, 2004; accepted January 10, 2005.


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Jung M. Inhibitors of histone deacetylase as new anticancer agents. Curr Med Chem 2001;8:1505–11.[Medline]
  2. Kelly WK, O'Connor OA, Marks PA. Histone deacetylase inhibitors: from target to clinical trials. Expert Opin Investig Drugs 2002;11:1695–713.[CrossRef][Medline]
  3. Vigushin DM, Coombes RC. Histone deacetylase inhibitors in cancer treatment. Anticancer Drugs 2002;13:1–13.[CrossRef][Medline]
  4. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem 1999;274:34940–7.[Abstract/Free Full Text]
  5. Vigushin DM, Ali S, Pace PE, et al. Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin Cancer Res 2001;7:971–6.[Abstract/Free Full Text]
  6. Johnstone RW. Histone-deacetylase inhibitors: novel drugs for the treatment of cancer. Nat Rev Drug Discov 2002;1:287–99.[CrossRef][Medline]
  7. Karin M, Cao Y, Greten FR, Li ZW. NF-{kappa}B in cancer: from innocent bystander to major culprit. Nat Rev Cancer 2002;2:301–10.[CrossRef][Medline]
  8. Karin M. How NF-{kappa}B is activated: the role of the I{kappa}B kinase (IKK) complex. Oncogene 1999;18:6867–74.[CrossRef][Medline]
  9. Karin M, Delhase M. The I{kappa}B kinase (IKK) and NF-{kappa}B: key elements of proinflammatory signalling. Semin Immunol 2000;12:85–98.[CrossRef][Medline]
  10. Whiteside ST, Israel A. I{kappa}B proteins: structure, function and regulation. Semin Cancer Biol 1997;8:75–82.[CrossRef][Medline]
  11. Israel A. The IKK complex: an integrator of all signals that activate NF-{kappa}B?Trends Cell Biol 2000;10:129–33.[CrossRef][Medline]
  12. Israel A. A role for phosphorylation and degradation in the control of NF-{kappa}B activity. Trends Genet 1995;11:203–5.[CrossRef][Medline]
  13. Lin L, DeMartino GN, Greene WC. Cotranslational dimerization of the Rel homology domain of NF-{kappa}B1 generates p50-p105 heterodimers and is required for effective p50 production. EMBO J 2000;19:4712–22.[CrossRef][Medline]
  14. Lin L, DeMartino GN, Greene WC. Cotranslational biogenesis of NF-{kappa}B p50 by the 26S proteasome. Cell 1998;92:819–28.[CrossRef][Medline]
  15. Betts JC, Nabel GJ. Differential regulation of NF-{kappa}B2(p100) processing and control by amino-terminal sequences. Mol Cell Biol 1996;16:6363–71.[Abstract]
  16. Coope HJ, Atkinson PG, Huhse B, et al. CD40 regulates the processing of NF-{kappa}B2 p100 to p52. EMBO J 2002;21:5375–85.[CrossRef][Medline]
  17. Xiao G, Cvijic ME, Fong A, et al. Retroviral oncoprotein Tax induces processing of NF-{kappa}B2/p100 in T cells: evidence for the involvement of IKK{alpha}. EMBO J 2001;20:6805–15.[CrossRef][Medline]
  18. Xiao G, Harhaj EW, Sun SC. NF-{kappa}B-inducing kinase regulates the processing of NF-{kappa}B2 p100. Mol Cell 2001;7:401–9.[CrossRef][Medline]
  19. Fong A, Sun SC. Genetic evidence for the essential role of ß-transducin repeat-containing protein in the inducible processing of NF-{kappa}B2/p100. J Biol Chem 2002;277:22111–4.[Abstract/Free Full Text]
  20. Zhong H, May MJ, Jimi E, Ghosh S. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol Cell 2002;9:625–36.[CrossRef][Medline]
  21. Chen L, Fischle W, Verdin E, Greene WC. Duration of nuclear NF-{kappa}B action regulated by reversible acetylation. Science 2001;293:1653–7.[Abstract/Free Full Text]
  22. Chen LF, Mu Y, Greene WC. Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-{kappa}B. EMBO J 2002;21:6539–48.[CrossRef][Medline]
  23. Kiernan R, Bres V, Ng RW, et al. Post-activation turn-off of NF-{kappa}B-dependent transcription is regulated by acetylation of p65. J Biol Chem 2003;278:2758–66.[Abstract/Free Full Text]
  24. Furia B, Deng L, Wu K, et al. Enhancement of nuclear factor-{kappa}B acetylation by coactivator p300 and HIV-1 Tat proteins. J Biol Chem 2002;277:4973–80.[Abstract/Free Full Text]
  25. Deng WG, Zhu Y, Wu KK. Up-regulation of p300 binding and p50 acetylation in tumor necrosis factor-{alpha}-induced cyclooxygenase-2 promoter activation. J Biol Chem 2003;278:4770–7.[Abstract/Free Full Text]
  26. Joyce D, Albanese C, Steer J, Fu M, Bouzahzah B, Pestell RG. NF-{kappa}B and cell-cycle regulation: the cyclin connection. Cytokine Growth Factor Rev 2001;12:73–90.[CrossRef][Medline]
  27. Rosato RR, Almenara JA, Grant S. The histone deacetylase inhibitor MS-275 promotes differentiation or apoptosis in human leukemia cells through a process regulated by generation of reactive oxygen species and induction of p21CIP1/WAF1 1. Cancer Res 2003;63:3637–45.[Abstract/Free Full Text]
  28. Han JW, Ahn SH, Kim YK, et al. Activation of p21(WAF1/Cip1) transcription through Sp1 sites by histone deacetylase inhibitor apicidin: involvement of protein kinase C. J Biol Chem 2001;276:42084–90.[Abstract/Free Full Text]
  29. Han JW, Ahn SH, Park SH, et al. Apicidin, a histone deacetylase inhibitor, inhibits proliferation of tumor cells via induction of p21WAF1/Cip1 and gelsolin. Cancer Res 2000;60:6068–74.[Abstract/Free Full Text]
  30. Bates S, Peters G. Cyclin D1 as a cellular proto-oncogene. Semin Cancer Biol 1995;6:73–82.[CrossRef][Medline]
  31. Sherr CJ. Cancer cell cycles. Science 1996;274:1672–7.[Abstract/Free Full Text]
  32. Haq F, Mahoney M, Koropatnick J. Signaling events for metallothionein induction. Mutat Res 2003;533:211–26.[Medline]
  33. Smith CL, Wolford RG, O'Neill TB, Hager GL. Characterization of transiently and constitutively expressed progesterone receptors: evidence for two functional states. Mol Endocrinol 2000;14:956–71.[Abstract/Free Full Text]
  34. Colburn NH, Wendel EJ, Abruzzo G. Dissociation of mitogenesis and late-stage promotion of tumor cell phenotype by phorbol esters: mitogen-resistant variants are sensitive to promotion. Proc Natl Acad Sci U S A 1981;78:6912–6.[Abstract/Free Full Text]
  35. Hsu TC, Nair R, Tulsian P, et al. Transformation nonresponsive cells owe their resistance to lack of p65/nuclear factor-{kappa}B activation. Cancer Res 2001;61:4160–8.[Abstract/Free Full Text]
  36. Hirose T, Sowa Y, Takahashi S, et al. p53-independent induction of Gadd45 by histone deacetylase inhibitor: coordinate regulation by transcription factors Oct-1 and NF-Y. Oncogene 2003;22:7762–73.[CrossRef][Medline]
  37. Tsukahara T, Kannagi M, Ohashi T, et al. Induction of Bcl-x(L) expression by human T-cell leukemia virus type 1 Tax through NF-{kappa}B in apoptosis-resistant T-cell transfectants with Tax. J Virol 1999;73:7981–7.[Abstract/Free Full Text]
  38. Chen C, Edelstein LC, Gelinas C. The Rel/NF-{kappa}B family directly activates expression of the apoptosis inhibitor Bcl-x(L). Mol Cell Biol 2000;20:2687–95.[Abstract/Free Full Text]
  39. Hu J, Nakano H, Sakurai H, Colburn NH. Insufficient p65 phosphorylation at S536 specifically contributes to the lack of NF-{kappa}B activation and transformation in resistant JB6 cells. Carcinogenesis 2004;25:1991–2003.[Abstract/Free Full Text]
  40. Prives C, Manley JL. Why is p53 acetylated? Cell 2001;107:815–8.[CrossRef][Medline]
  41. Terui T, Murakami K, Takimoto R, et al. Induction of PIG3 and NOXA through acetylation of p53 at 320 and 373 lysine residues as a mechanism for apoptotic cell death by histone deacetylase inhibitors. Cancer Res 2003;63:8948–54.[Abstract/Free Full Text]
  42. DiDonato J, Mercurio F, Rosette C, et al. Mapping of the inducible I{kappa}B phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol 1996;16:1295–304.[Abstract]
  43. Johnstone RW, Licht JD. Histone deacetylase inhibitors in cancer therapy: is transcription the primary target? Cancer Cell 2003;4:13–8.[CrossRef][Medline]
  44. Adam E, Quivy V, Bex F, et al. Potentiation of tumor necrosis factor-induced NF-{kappa}B activation by deacetylase inhibitors is associated with a delayed cytoplasmic reappearance of I{kappa}B{alpha}. Mol Cell Biol 2003;23:6200–9.[Abstract/Free Full Text]
  45. Mariadason JM, Corner GA, Augenlicht LH. Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer. Cancer Res 2000;60:4561–72.[Abstract/Free Full Text]
  46. Yin L, Laevsky G, Giardina C. Butyrate suppression of colonocyte NF-{kappa}B activation and cellular proteasome activity. J Biol Chem 2001;276:44641–6.[Abstract/Free Full Text]
  47. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Transcriptional signature of histone deacetylase inhibition in multiple myeloma: biological and clinical implications. Proc Natl Acad Sci U S A 2004;101:540–5.[Abstract/Free Full Text]
  48. Mordmuller B, Krappmann D, Esen M, Wegener E, Scheidereit C. Lymphotoxin and lipopolysaccharide induce NF-{kappa}B-p52 generation by a co-translational mechanism. EMBO Rep 2003;4:82–7.[CrossRef][Medline]
  49. Viatour P, Bentires-Alj M, Chariot A, et al. NF-{kappa}B2/p100 induces Bcl-2 expression. Leukemia 2003;17:1349–56.[CrossRef][Medline]
  50. Darnell JE Jr. Transcription factors as targets for cancer therapy. Nat Rev Cancer 2002;2:740–9.[CrossRef][Medline]
  51. Kramer OH, Gottlicher M, Heinzel T. Histone deacetylase as a therapeutic target. Trends Endocrinol Metab 2001;12:294–300.[CrossRef][Medline]
  52. Rascle A, Johnston JA, Amati B. Deacetylase activity is required for recruitment of the basal transcription machinery and transactivation by STAT5. Mol Cell Biol 2003;23:4162–73.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
L. Andresen, H. Jensen, M. T. Pedersen, K. A. Hansen, and S. Skov
Molecular Regulation of MHC Class I Chain-Related Protein A Expression after HDAC-Inhibitor Treatment of Jurkat T Cells
J. Immunol., December 15, 2007; 179(12): 8235 - 8242.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
H. Dombrowsky and S. Uhlig
Steroids and histone deacetylase in ventilation-induced gene transcription
Eur. Respir. J., November 1, 2007; 30(5): 865 - 877.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. Matteucci, E. Ridolfi, P. Maroni, P. Bendinelli, and M. A. Desiderio
c-Src/Histone Deacetylase 3 Interaction Is Crucial for Hepatocyte Growth Factor Dependent Decrease of CXCR4 Expression in Highly Invasive Breast Tumor Cells
Mol. Cancer Res., August 1, 2007; 5(8): 833 - 845.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Hu, J. Straub, D. Xiao, S. V. Singh, H.-S. Yang, N. Sonenberg, and J. Vatsyayan
Phenethyl Isothiocyanate, a Cancer Chemopreventive Constituent of Cruciferous Vegetables, Inhibits Cap-Dependent Translation by Regulating the Level and Phosphorylation of 4E-BP1
Cancer Res., April 15, 2007; 67(8): 3569 - 3573.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Duan, J. Friedman, L. Nottingham, Z. Chen, G. Ara, and C. Van Waes
Nuclear factor-{kappa}B p65 small interfering RNA or proteasome inhibitor bortezomib sensitizes head and neck squamous cell carcinomas to classic histone deacetylase inhibitors and novel histone deacetylase inhibitor PXD101
Mol. Cancer Ther., January 1, 2007; 6(1): 37 - 50.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.