Molecular Cancer Research CR Podcast
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qin, L.
Right arrow Articles by Zeng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qin, L.
Right arrow Articles by Zeng, H.
Molecular Cancer Research 4:811-820 (2006)
© 2006 American Association for Cancer Research

Angiogenesis, Metastasis, and the Cellular Microenvironment

Down Syndrome Candidate Region 1 Isoform 1 Mediates Angiogenesis through the Calcineurin-NFAT Pathway

Liuliang Qin1, Dezheng Zhao2, Xin Liu1, Janice A. Nagy1, Mien Van Hoang1, Lawrence F. Brown1, Harold F. Dvorak1 and Huiyan Zeng1

Departments of 1 Pathology and 2 Medicine, Gastroenterology Division, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts

Requests for reprints: Huiyan Zeng, Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, 99 Brookline Avenue RN 270A, Boston, MA 02215. Phone: 617-667-2329; Fax: 617-667-3591. E-mail: hzeng{at}caregroup.harvard.edu.


   Abstract
Top
 Notes
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Down syndrome candidate region 1 (DSCR1) is one of more than 50 genes located in a region of chromosome 21 that has been implicated in Down syndrome. DSCR1 can be expressed as four isoforms, one of which, isoform 4 (DSCR1-4), has recently been found to be strongly induced by vascular endothelial growth factor A (VEGF-A165) and to provide a negative feedback loop that inhibits VEGF-A165-induced endothelial cell proliferation in vitro and angiogenesis in vivo. We report here that another DSCR1 isoform, DSCR1-1L, is also up-regulated by VEGF-A165 in cultured endothelial cells and is strongly expressed in several types of pathologic angiogenesis in vivo. In contrast to DSCR1-4, the overexpression of DSCR1-1L induced the proliferation and activation of the transcription factor NFAT in cultured endothelial cells and promoted angiogenesis in Matrigel assays in vivo, even in the absence of VEGF-A. Similarly, small interfering RNAs specific for DSCR1-1L and DSCR1-4 had opposing inhibitory and stimulatory effects, respectively, on these same functions. DSCR1-4 is thought to inhibit angiogenesis by inactivating calcineurin, thereby preventing activation and nuclear translocation of NFAT, a key transcription factor. In contrast, DSCR1-1L, regulated by a different promoter than DSCR1-4, activates NFAT and its proangiogenic activity is inhibited by cyclosporin, an inhibitor of calcineurin. In sum, DSCR1-1L, unlike DSCR1-4, potently activates angiogenesis and could be an attractive target for antiangiogenesis therapy. (Mol Cancer Res 2006;4(11):811–20)


   Introduction
Top
 Notes
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 References
 
Down syndrome candidate region 1 (DSCR1) is one of more than 50 genes present in that portion of chromosome 21 that is duplicated in trisomy 21, the chromosomal abnormality responsible for Down syndrome (1-3). DSCR1 is identical to MCIP1 (modulatory calcineurin–interacting protein; ref. 4). It is homologous to Adapt78, an oxidant stress-inducible gene in hamsters (5-7) and also to Rcn1/nebula in Drosophila (8). Down syndrome is a major cause of mental retardation and is also associated with various cardiac and gastrointestinal anomalies, immune system defects, and Alzheimer's disease. Of relevance to cancer, patients with Down syndrome have an increased risk of certain malignancies (leukemia, germ cell tumors) but an extremely low incidence of many solid tumors, particularly breast cancer (9, 10). On the other hand, clinically aggressive ovarian carcinomas often have trisomy of chromosome 21, whereas certain other solid tumors have deletions of this chromosome. Together, these and other data suggest that genes such as DSCR1 that are duplicated in Down syndrome may play important roles in tumorigenesis (11, 12).

Interest in DSCR1 has recently been sparked by several reports indicating that it is up-regulated in cultured vascular endothelial cells by vascular endothelial growth factor (VEGF-A165), and furthermore, that it provides a negative feedback loop that inhibits VEGF-A165-induced angiogenesis (13-16). However, these conclusions were based on the study of only one DSCR1 isoform, isoform 4 (DSCR1-4). The DSCR1 gene is comprised of seven exons, the first four of which can serve as start sites that then combine with exons 5 to 7 to produce four different mRNA transcripts (2, 17). Exon 1 was originally thought to encode a 29–amino acid peptide (DSCR1-1; refs. 2, 17), but later studies by Genesca et al. (18) revealed a start site further upstream that encoded an 84–amino acid peptide (DSCR1-1L). Exon 2 is probably not translated into protein because it lacks a methionine start site. Exon 3 encodes only three amino acids (2, 17). Exon 4, under the control of a different promoter from that regulating isoforms 1 to 3 (2, 17), encodes a 29–amino acid peptide that initiates a fourth DSCR1 isoform. Several DSCR1 isoforms have different expression patterns and likely different functions and regulatory mechanisms (2, 17). All four isoforms are expressed in heart and skeletal muscle (2, 17). Isoform 1 has also been detected in brain, whereas isoform 4 has been detected in placenta and kidney (2, 17). DSCR1-1L has been found to play a protective role against cell stress (5-7). In addition to inhibiting angiogenesis (13-16), DSCR1-4 plays an inhibitory role in cardiac and skeletal muscle hypertrophy (19-21).

The present study was undertaken to determine whether other DSCR1 isoforms had roles in angiogenesis analogous to that of DSCR1-4. We report here that DSCR1-1L, like DSCR1-4, is up-regulated by VEGF-A165 in cultured endothelial cells and also in several types of pathologic angiogenesis in vivo. DSCR1-1L is also expressed in the microvasculature of at least some human ovarian cancers, but not in the tumor cells themselves nor in the microvessels of normal ovary. Of particular interest, the effects of DSCR1-1L in angiogenesis are antithetical to those of DSCR1-4. Using a novel modification of the standard Matrigel assay, we found that overexpression of DSCR1-1L promoted endothelial cell proliferation in vitro and angiogenesis in vivo, whereas a DSCR1-1L–specific small interfering RNA (siRNA) had opposite effects. Furthermore, whereas DSCR1-4 binds to calcineurin and prevents it from activating the transcription factor NFAT, DSCR1-1L activates the calcineurin-NFAT pathway. Taken together, our data indicate that DSCR1 isoforms 1 and 4 have opposing stimulatory and inhibitory effects on VEGF-A164/5-induced angiogenesis.


   Results
Top
 Notes
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 References
 
Up-Regulation of DSCR1-1L In vitro and In vivo
In agreement with recent reports (13-15), we found that VEGF-A165 strongly up-regulated DSCR1 expression in human umbilical vein endothelial cells (HUVEC) as determined by DNA microarrays and quantitative real-time reverse transcription-PCR (RT-PCR). Maximum DSCR1 mRNA expression appeared 1 hour after serum-starved HUVEC were stimulated with 10 ng/mL of VEGF-A165 (data not shown). We then set out to determine whether DSCR1 isoforms 1 and 4 were regulated differentially by VEGF-A165 in vascular endothelium. Because isoform-specific internal probes could not be developed for quantitative real-time reverse transcription-PCR, we used semiquantitative RT-PCR to evaluate the expression of DSCR1 isoforms. Using NH2-terminal-specific primers (17), we found that VEGF-A165 up-regulated both DSCR1-1L and DSCR1-4 mRNAs in serum-starved HUVEC and human microdermal vascular endothelial cells (HMDVEC; Fig. 1A ). Immunoblots revealed that DSCR1-1L protein was up-regulated in HUVEC in a time-dependent fashion by VEGF-A165, but to a lesser extent than DSCR1-4 (Fig. 1B). Similar results were obtained with HMDVEC cells (data not shown).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. Regulation of DSCR1 isoform expression in vitro. A. Up-regulation of DSCR1 isoforms 1L and 4 in HUVEC and HMDVEC stimulated with VEGF-A165 as determined by semiquantitative RT-PCR using isoform-specific primers. In the case of DSCR1-4, two bands are apparent; only the lower of these (arrow) is authentic, as was proved by DNA sequencing; the upper band reflects a lack of PCR primer specificity. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves as an internal loading control. B. Immunoblot of DSCR1 isoforms 1L and 4 in HUVEC that were serum-starved (0.1% fetal bovine serum) for 24 hours and stimulated with 10 ng/mL of VEGF-A165 for 1, 2, 4, and 6 hours.

 
To evaluate the role of DSCR1 in vascular endothelium in vivo, we made use of an established angiogenesis assay in which an adenoviral vector expressing mVEGF-A164 (mouse equivalent of human VEGF-A165) was injected into nude mouse ear skin; an adenoviral vector expressing LacZ, that did not induce angiogenesis, served as a control (22). Ears were harvested at different stages of the angiogenic response and prepared for immunoblot assays. Using an antibody that recognized all mouse DSCR1 isoforms, we found that DSCR1 protein was highly up-regulated as angiogenesis developed, reaching a peak on day 3 (Fig. 2A ). DSCR1 expression was not stimulated by Ad-LacZ. DSCR1 protein was also up-regulated in the angiogenic response that was induced in the mesenteries of nude mice bearing ascites mouse ovarian tumor (MOT; Fig. 2A).


Figure 2
View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 2. Regulation of DSCR1 and DSCR1 isoform expression in vivo. A. Immunoblot with a mDSCR1 antibody demonstrating time-dependent up-regulation of DSCR1 protein in mouse ears injected with 108 PFU of Ad-mVEGF-A164 and in mouse mesenteries at various times after i.p. injection of 106 MOT ascites tumor cells. A control adenovirus expressing LacZ did not induce DSCR1 protein expression; blots were stripped and probed with an anti–mitogen-activated protein kinase (MAPK) antibody to confirm equal protein loading (bottom). B. Time-dependent up-regulation of mRNAs of DSCR1 isoforms 1L and 4 in mouse tissues as determined by RT-PCR. Lanes 1 and 2, mouse ears following injection of 108 PFU of Ad-mVEGF-A164 or Ad-LacZ. Lane 3, mesenteries from mice injected i.p. with 106 MOT ascites tumor cells. No DSCR1 isoform 1L and only trace amounts of DSCR1-4 were detected in MOT tumor cells (lane 4). Glyceraldehyde-3-phosphate dehydrogenase served as an internal control for equal RNA loading. All experiments were repeated thrice. C. Immunohistochemical staining of normal human ovarian tissue (top) and a human ovarian adenocarcinoma (bottom) with antibodies specific for human CD31 (a and b), DSCR1-1L (c and d), and DSCR1-4 (e and f). Vessels (arrows) in normal and tumor tissue were CD31-positive, but only those in tumors stained with antibodies to DSCR1-1L and DSCR1-4. Tissue from one of five different patients, all of which exhibited similar staining.

 
We next determined which DSCR1 isoforms were up-regulated in Ad-mVEGF-A164–induced angiogenesis, using semiquantitative RT-PCR (Fig. 2B). We found that both DSCR1-1L and DSCR1-4 RNAs were induced by Ad-mVEGF-A164, peaking at 12 hours after ear injection (lane 1); Ad-LacZ did not stimulate expression of either isoform (lane 2). DSCR1-1L and DSCR1-4 were also both up-regulated in the mesenteries of mice bearing MOT ascites tumors (lane 3). However, MOT cells themselves did not express detectable amounts of DSCR1-1L and only trace amounts of DSCR1-4 (lane 4).

Specific antibodies are available against human DSCR1 isoforms 1 and 4, and we used these to perform immunohistochemistry on five cases of human ovarian adenocarcinoma. Both DSCR1-1L and DSCR1-4 were selectively expressed in the tumor vascular endothelium but not in the tumor cells nor in the vessels of adjacent normal ovarian tissue (Fig. 2C). Together, these data indicate that both DSCR1-1L and DSCR1-4 are highly expressed in the newly formed vessels of several types of pathologic angiogenesis in mice and in at least some human ovarian cancers.

Transfection of HUVEC with Full-Length DSCR1 Isoforms or with Isoform-Specific siRNAs
We used two approaches to investigate the effects of DSCR1 isoforms on vascular endothelium. First, we used RT-PCR to clone full-length DSCR1-1L, DSCR1-3, and DSCR1-4 cDNAs from total RNA that we isolated from HUVEC that had been treated for 1 hour with VEGF-A165. After confirming their identity by DNA sequencing, we fused the Flag sequence in-frame to the NH2 terminus of each and subcloned the products into a retroviral expression vector that gave nearly 100% infection yields in HUVEC (23). Cell extracts from HUVEC transduced with Flag-fused versions of DSCR1-1L (FD1L), DSCR1-3 (FD3), DSCR1-4 (FD4), and LacZ (FLacZ), were immunoprecipitated with an antibody against Flag and immunoblotted with an antibody reactive against all human DSCR1 isoforms. Figure 3A shows that FD1L, FD3, FD4, and Lac Z proteins were all expressed in HUVEC.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 3. Roles of DSCR1-1L and DSCR1-4 in HUVEC proliferation. A. Cell extracts from HUVEC transduced with Flag-DSCR1-4 (FD4 cells), Flag-DSCR1-1L (FD1L cells), Flag DSCR1-3 (FD3 cells), and Flag-LacZ (FLacZ cells) were immunoprecipitated with an antibody against Flag and the precipitates immunoblotted with an antibody reactive with all human DSCR1 isoforms (top). Expression of mitogen-activated protein kinase (MAPK) indicates equal protein loading (bottom). B. Cell extracts from HUVEC transduced with isoform-specific siRNAs or with a scrambled DSCR1-4 siRNA (Neg-Si) were immunoblotted with antibodies specific for hDSCR1-1L and hDSCR1-4. D1Si specifically knocked down the expression of DSCR1-1L but had no effect on DSCR1-4. D4Si specifically knocked down the expression of DSCR1-4 but had no effect on DSCR1-1L. Neg-Si had no effect on either DSCR1-1L or DSCR1-4 expression. C. HUVEC were transduced with retroviruses as indicated, then serum-starved and cultured with or without VEGF-A165 for 24 hours before assessing 3H-thymidine incorporation as a measure of cell proliferation (see Materials and Methods). See text for statistical comparisons (n = 4).

 
As a second approach, we designed siRNAs that specifically targeted the NH2-terminal sequence of DSCR1-1L (D1Si) and DSCR1-4 (D4Si), as well as a control siRNA (Neg-Si, a scrambled version of the D4Si sequence). Cell extracts from HUVEC that had been infected with retroviruses expressing these siRNAs were immunoblotted with antibodies specific for DSCR1-1L and DSCR1-4. D1Si and D4Si strongly and specifically inhibited the expression of DSCR1-1 and DSCR1-4, respectively, whereas Neg-Si had no effect on either (Fig. 3B).

Effects of DSCR1 Isoforms and Isoform-Specific siRNAs on HUVEC Proliferation
As expected, VEGF-A165 stimulated (24) thymidine incorporation in control HUVEC and in HUVEC transduced with LacZ (Fig. 3C, lane 2 versus lane 1 and lane 4 versus lane 3, both P < 0.001). HUVEC transduced with FD1L showed significantly increased thymidine incorporation in the absence of VEGF-A165 (lane 5 versus lane 3, P < 0.001), and further enhanced thymidine incorporation following VEGF-A165 stimulation (lane 6 versus lanes 5 and 4, P < 0.01). Baseline thymidine incorporation was unaffected in FD4-transduced cells (lane 7 versus lanes 1 or 3, P > 0.05) but the response to VEGF-A165 was strikingly inhibited (lane 8 versus lanes 2 or 4, P < 0.001).

Transduction with the DSCR1-1L-specific siRNA D1Si did not affect baseline thymidine incorporation (lane 11 versus lanes 1 or 3, P > 0.05) but significantly inhibited VEGF-A165-induced stimulation (lane 12 versus lanes 2 or 4, P < 0.001). On the other hand, transduction with the DSCR1-4-specific siRNA D4Si significantly enhanced thymidine incorporation both in the absence and presence of VEGF-A165 (lane 13 versus lanes 1 or 3; lane 14 versus lanes 2 or 4, both P < 0.001). Control Neg-Si had no effect on thymidine incorporation in HUVEC with or without VEGF-A165 stimulation (lane 15 versus lanes 1 or 3; lane 16 versus lanes 2 or 4, both P > 0.05). Transduction with FD3 also had no effect on thymidine incorporation without VEGF-A165 (lane 9 versus lanes 1 or 3, P > 0.05) or following its addition (lane 10 versus lanes 2 or 4, P > 0.05).

We next tested whether DSCR1 isoform-specific siRNAs had effects on KDR (VEGF receptor 2) expression or on VEGF-A165-induced KDR phosphorylation. Serum-starved HUVEC that had been transduced with D1Si, D4Si, or with control Neg-Si were stimulated with 10 ng/mL of VEGF-A165 for 2 minutes. Cell extracts were immunoprecipitated with an antibody against KDR and immunoblotted with an antibody against phosphorylated tyrosine (PY20). Neither D1Si nor D4Si had any effect on VEGF-A165-stimulated KDR phosphorylation (Supplementary Fig. S1, top). The blot was then stripped and reprobed with an antibody against KDR. The expression of KDR was also not affected by D1Si or D4Si transduction (Supplementary Fig. S1, bottom). These data indicate that, as anticipated, the effects of D1Si and D4Si on VEGF-A165-stimulated HUVEC proliferation are not due to the inhibition of KDR expression or phosphorylation.

Effects of DSCR1 Isoforms on VEGF-A-Induced Angiogenesis In vivo
In order to elucidate the mechanisms of angiogenesis, it would be desirable to modulate the expression of individual vascular genes in vivo using the gene overexpression and silencing approaches that have proved to be so powerful in vitro. Recently, a novel system has been developed that allowed us to introduce DSCR1 isoform–specific cDNAs or siRNAs into endothelial cells in vivo (25-27). SK-MEL-2 tumor cells transfected to overexpress VEGF-A165 (SK-MEL/VEGF cells; ref. 27) were mixed with PT67 cells packaging retroviruses that expressed full-length DSCR1 isomer cDNAs or their respective siRNAs. The cell mixtures were incorporated into Matrigels that were implanted in the s.c. space of nude mice. As previously reported (25-27), VEGF-A165 secreted by SK-MEL/VEGF cells induces nearby vascular endothelial cells to divide and therefore to become susceptible to infection with retroviruses secreted by PT67 packaging cells.

The angiogenic response that developed after the implantation of Matrigel plugs containing various cell mixtures was evaluated on day 3 (Fig. 4A ). Angiogenesis was assessed by macroscopy (top) and by histology and immunohistochemistry for the endothelial cell marker CD31 (bottom). Matrigel plugs containing only PT67 cells packaging LacZ-expressing retroviruses (PT67/LacZ cells) induced minimal angiogenesis (lane 1). However, strong angiogenesis with typical "mother" vessels was induced in plugs containing SK-MEL/VEGF cells, whether alone or combined with PT67/LacZ cells (lanes 2 and 3). Mother vessels are enlarged, thin-walled, pericyte-poor vessels that are the first new vessel type induced by VEGF-A164 in vivo (22). The angiogenic response and mother vessel formation were strikingly depressed by the inclusion of PT67/D1Si cells (lane 4) but were not affected by the inclusion of either PT67/D4Si or PT67/Neg-Si cells (lanes 5 and 6). However, the inclusion of PT67/FD4 cells completely inhibited VEGF-A-induced angiogenesis and mother vessel formation (lane 7), whereas overexpression of FD1L was associated with strong angiogenesis (lane 8). The inclusion of PT67/FD3 cells had no effect on the angiogenic response induced by SKMEL/VEGF cells (lane 9). Immunostaining with antibody against DSCR1 indicated that DSCR1 was induced in the vessel structure (Supplementary Fig. S2, a, arrows), which was almost completely inhibited by D1Si or D4Si (Supplementary Fig. S2, b and c, arrows), but was not affected by SiNeg (Supplementary Fig. S2, d, arrow). In situ hybridization also confirmed the knockdown of DSCR1 expression by D1Si and D4Si (data not shown). Furthermore, in situ hybridization indicated that the expression levels of VEGF-A165 were similar in Matrigels containing these different cell mixtures (see ref. 25); also, transfection of SKMEL and PT67 cells with FD1L, FD4, and etc., has no effect on these cells' proliferation. Therefore, the results obtained cannot be attributed to the effects of VEGF-A expression.


Figure 4
View larger version (73K):
[in this window]
[in a new window]
  		FIGURE 4. DSCR1-1 stimulates, whereas DSCR1-4 inhibits, VEGF-A165-induced angiogenesis in the in vivo Matrigel assay. A and B. Macroscopic (top) and CD31-stained microscopic (bottom) images of the angiogenic response induced in Matrigels 3 days after implantation with indicated contents of VEGF-A165-secreting SKMEL/VEGF cells and PT67 cells generating LacZ, D1Si, D4Si, Neg-Si, FD1L, FD3, and FD4 retroviruses; all experiments were repeated thrice. C. Intravascular plasma volumes (µL/g) in Matrigels from (A and B) as a quantitative measure of the angiogenic response. Intravascular plasma volumes were determined by the accumulation of Evan's blue dye administered i.v. 5 minutes prior to euthanasia (n = 4). D. Effect of cyclosporin A, a calcineurin inhibitor, on DSCR1-1L-induced angiogenesis in the Matrigel assay. Left, typical macroscopic and microscopic data as in (A) and Supplementary Fig. S2. Right, intravascular plasma volumes measured by the Evan's blue dye assay as in (B; n = 4). All experiments were repeated twice.

 
We next tested whether the overexpression of DSCR1-1L could induce angiogenesis in the absence of VEGF-A165 (Fig. 4B). Matrigels containing only PT67/FD1L cells were able to induce angiogenesis and mother vessel formation (lane 2) to an extent similar to that induced by VEGF-A165-expressing cells (lane 1). However, Matrigels containing only PT67/FD3 did not induce angiogenesis (lane 3). When DSCR1-4 expressing FD4 cells were included in Matrigels along with DSCR1-1L expressing FD1L cells in the absence of SKMEL/VEGF cells, the angiogenic response expected from FD1L cells was abrogated (lane 4). Immunostaining and in situ hybridization confirmed the similar expression of DSCR1-1, DSCR1-3, and DSCR1-4 with an antibody against Flag (Supplementary Fig. S3; data not shown).

To confirm that the angiogenesis induced by PT67/FD1L was not due to the induction of VEGF-A expression, we made use of SU1498, an inhibitor of VEGF receptor 2/KDR kinase activity (KDR is the VEGF-A receptor responsible for mediating the angiogenic response; ref. 28). When incorporated into Matrigel plugs and administered systemically, SU1498 strongly inhibited angiogenesis in Matrigel plugs containing SKMEL/VEGF cells, but had no inhibitory effect on the angiogenesis induced by PT67 cells expressing FD1L (Supplementary Fig. S4). Taken together, these data provide strong evidence that DSCR1-1 can induce angiogenesis and mother vessel formation even in the absence of exogenous VEGF-A165 and that DSCR1-4 inhibits that response.

Quantification of the Effects of DSCR1 Isoforms and siRNAs on Angiogenesis
We next used the intravascular plasma volume of Matrigel plug–associated blood vessels as a novel measure to quantitate the angiogenic response induced by VEGF-A165 and DSCR1 isoforms (25). Intravascular plasma volume is an appropriate measure as enlarged mother vessels are a signature property of the early angiogenic response to VEGF-A (22, 29). Evan's blue dye was injected i.v. into mice 3 days after implanting Matrigel plugs containing various cell mixtures. Evan's blue dye binds to plasma proteins, and therefore, the amount of plasma within the Matrigel-associated vasculature can be calculated from simultaneous measurements of dye concentration in peripheral blood plasma. Matrigel plugs were harvested 5 minutes after i.v. dye injection, when blood vessels were filled with dye-plasma protein complexes, but before there was time for significant extravasation.

In Matrigel plugs containing VEGF-A165-expressing SKMEL/VEGF cells (alone or with PT67/LacZ cells), intravascular plasma volume as measured by Evan's blue dye accumulation increased >2-fold above baseline levels (Fig. 4C, lanes 2 or 3 versus lane 1, P < 0.001). The presence of PT67/D1Si cells expressing DSCR1-1 siRNA strikingly blocked the angiogenic response expected from SKMEL/VEGF cells (Fig. 4C, lane 4 versus lanes 2 and 3, P < 0.001). However, cells expressing DSCR1-4 siRNA (D4Si) or control siRNA (Neg-Si) had no effect on the angiogenic response induced by SKMEL/VEGF cells (Fig. 4C, lanes 5 and 6 versus lanes 2 or 3, P > 0.05). The inclusion of PT67/FD1L cells expressing DSCR1-1L or PT67/FD3 cells expressing DSCR1-3 also had no effect (Fig. 4C, lanes 7 and 8 versus lanes 2 or 3, P > 0.05). However, when PT67/FD4 cells expressing DSCR1-4 were incorporated in Matrigel plugs, the increased dye accumulation expected from SKMEL/VEGF cells was strongly inhibited (Fig. 4C, lane 9 versus lanes 2 or 3, P < 0.001). In the absence of SKMEL/VEGF cells, dye accumulation in Matrigel plugs containing PT67/FD1L cells was similar to that of Matrigels containing SKMEL/VEGF cells (Fig. 4C, lane 10 versus lane 2, P > 0.05). However, dye accumulation in Matrigels containing PT67/FD3 or PT67/FD4 cells was similar to that of Matrigels containing PT67/LacZ cells (Fig. 4C, lanes 11 or 12, versus lane 1, P > 0.05). The quantitative measurements of vascular plasma volumes presented in Fig. 4C therefore confirm the qualitative measures of angiogenesis presented in Fig. 4A and B.

Effects of DSCR1-1L and DSCR1-4 on the Calcineurin-NFAT Pathway
The COOH-terminal domain of DSCR1 has been shown to bind to calcineurin and to inhibit its activity, preventing the activation (dephosphorylation) of NFAT and its translocation to the nucleus (13-16, 30). However, a recent report has shown that phosphorylation of RCN1, the Drosophila orthologue of MCIP1/DSCR1, has an opposite effect, enhancing calcineurin activity (31). These results suggested to us that different DSCR1 isoforms might be responsible for these opposite effects of DSCR1 on calcineurin binding and activation. To test this possibility, we investigated the effects of DSCR1-1L on the calcineurin pathway. We included cyclosporin A, an inhibitor of calcineurin, in Matrigel plugs containing FD1L cells that expressed DSCR1-1L; cyclosporin A was also injected i.p. daily. As shown in Fig. 4D, cyclosporin A strongly inhibited DSCR1-1L-induced angiogenesis, suggesting that DSCR1-1L regulated angiogenesis through calcineurin activation.

We next tested the effects of DSCR1 isoforms and their specific siRNAs on NFATc1-dependent reporter expression. NFATc1 is the only NFAT protein that is activated by VEGF in endothelial cells (32). HUVEC transduced with DSCR1 isoform cDNAs or their isoform-specific siRNAs were transfected with a NFATc1-targeted promoter-luciferase plasmid and an internal control luciferase plasmid, and then stimulated with VEGF-A165 for 6 hours. Luciferase activity was measured and normalized to the control luciferase activity for equal transfection efficiency. As shown in Fig. 5A , VEGF-A165 stimulated a ~2-fold increase in NFATc1 activity in HUVEC transduced with LacZ (lane 2 versus lane 1, P < 0.001). In HUVEC transduced with DSCR1-1L, NFAT activity was strongly up-regulated both in the absence and presence of VEGF-A165 (lane 3 versus lane 1 and lane 4 versus lane 2, both P < 0.001). By contrast, in FD4 cells that overexpressed DSCR1-4, baseline NFATc1 activity was strikingly reduced (lane 7 versus lane 1, P < 0.01) and the response to VEGF-A165 was strongly inhibited (lane 8 versus lane 2, P < 0.001). Overexpression of DSCR1-3 did not show a significant effect (lane 5 versus lane 1 and lane 6 versus lane 2, both P > 0.05). On the other hand, knocking down DSCR1-1L expression by its specific siRNA (D1Si) completely inhibited VEGF-A165-stimulated NFATc1 activity (lane 10 versus lane 2, P < 0.001), without affecting baseline activity (lane 9 versus lane 1, P > 0.05). D4Si, the DSCR1-4-specific siRNA, had an opposite effect, up-regulating NFATc1 activity both in the presence and absence of VEGF-A165 (lanes 11 and 12 versus lanes 1 and 2, respectively, although the effects were not statistically significant, P > 0.05). Control siRNA (Neg-Si) had no effect on NFATc1 activity in the presence or absence of VEGF-A165 (lane 13 versus lane 1 and lane 14 versus lane 2, both P > 0.05). We further tested whether the overexpression of DSCR1-1L induced DSCR1-4 expression. Cellular extracts from cells transduced with FD4, FLacZ, and FD1L were immunoblotted with an antibody against DSCR1. Figure 5B clearly indicated that overexpression of DSCR1-1L induced the expression of DSCR1-4 (Fig. 5B).


Figure 5
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 5. Differential regulation of calcineurin-NFATc1 pathway by DSCR1 isoforms. A. FD1L, FD3, FD4, LacZ, D1Si, D4Si, and Neg-Si cells were transfected with a NFATc1-regulated reporter gene. After 24 hours of serum starvation, cells were cultured with or without 10 ng/mL of VEGF for 6 hours. NFATc1 activity was expressed as the level of transcription activity of the promoter after normalization with standard (n = 6). B. Cellular extracts from HUVEC transduced with FD4 (lane 1), LacZ (lane 2), and FD1L (lane 3) were subjected to immunoblotting with an antibody against DSCR1. All experiments were repeated thrice.

 

   Discussion
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 References
 
Recent studies from several laboratories have shown that VEGF-A165 up-regulates DSCR1-4, one of four proposed DSCR1 isoforms, in vascular endothelial cells. DSCR1-4 then triggers a negative feedback loop that quenches VEGF-A165-induced endothelial cell proliferation and tube formation in vitro and angiogenesis in vivo (13-16). We have confirmed and extended these findings but have also shown for the first time that another DSCR1 isoform, DSCR1-1L, plays an important proangiogenic role that is opposite to and opposes that of DSCR1-4. On the other hand, expression of a third DSCR1 isomer, DSCR1-3, apparently does not have a significant role in VEGF-A165-mediated angiogenesis (Figs. 3C, 4, and 5).

VEGF-A165 up-regulated DSCR1-1L in HUVEC at both the mRNA and protein levels, although to a lesser extent than DSCR1-4 (Fig. 1A and B). In addition, both DSCR1-1L and DSCR1-4 were up-regulated in the angiogenic responses induced in vivo by a VEGF-A164-expressing adenovirus and by VEGF-A164-expressing MOT tumors (Fig. 2B). Of importance, the MOT tumor cells did not themselves express DSCR1-1L detectably, and expressed only trace amounts of DSCR1-4. Because antibodies reactive with mouse DSCR1 in tissue sections are not available, we could not further localize DSCR1 in these models. However, both DSCR1-1L and DSCR1-4 were selectively localized to the microvessels supplying human ovarian cancers (Fig. 2C).

Of considerable interest, DSCR1-1L and DSCR1-4 were found to have antithetical effects on the angiogenic response, both in vitro and in vivo. Consistent with earlier reports (13-16), overexpression of DSCR1-4 strikingly inhibited VEGF-A165-mediated 3H-thymidine incorporation in cultured HUVEC, whereas a DSCR1-4-specific siRNA (D4Si) stimulated such incorporation in both the presence and absence of added VEGF-A165 (Fig. 3C). Similarly, PT67/FD4 cells strongly inhibited angiogenesis in Matrigel assays in vivo, whereas PT67/D4Si cells had an opposite, proangiogenic effect (Fig. 4). In contrast, the overexpression of DSCR1-1L significantly increased 3H-thymidine incorporation above control levels both in the presence and absence of added VEGF-A165, whereas VEGF-A165-mediated stimulation of thymidine incorporation was strikingly inhibited in HUVEC transduced with a DSCR1-1L-specific siRNA (Fig. 3C). Also, PT67/FD1L cells overexpressing DSCR1-1L induced strong angiogenesis in the in vivo Matrigel assay in the presence or absence of a source of VEGF-A165, whereas the inclusion of PT67/D1Si cells expressing an DSCR1-1L-specific siRNA strongly inhibited VEGF-A165-induced angiogenesis (Fig. 4).

Taken together, these data indicate that, whereas DSCR1-4 provides a negative feedback loop, DSCR1-1L promotes and is actually required for VEGF-A165-mediated angiogenesis. Furthermore, mechanistic studies determined that isoform-specific DSCR1 siRNAs did not affect KDR expression or phosphorylation (Supplementary Fig. S1) and that the proangiogenic effect of DSCR1-1L was not inhibited by SU1496, an inhibitor of VEGF receptor 2 (KDR), the receptor through which VEGF-A165 mediates endothelial cell proliferation and angiogenesis (Supplementary Fig. S4). Therefore, DSCR1-1L must be acting downstream of VEGF-A and its receptor.

The antiangiogenic activity of DSCR1-4 has been attributed to its suppression of the calcineurin-NFAT pathway (refs. 14, 16; Fig. 6 ). Calcineurin is a calcium-regulated, serine/threonine phosphatase that is activated by VEGF-A and other growth factors to dephosphorylate and thereby activate the transcription factor, NFAT (14-16, 33). Activated NFAT translocates to the cell nucleus in which it acts cooperatively with other transcription factors to induce the expression of a large number of genes, including many that have roles in angiogenesis and inflammation. By binding to and inactivating calcineurin, DSCR1-4 reverses NFAT activation and shuts down the transcription of proangiogenic genes such as GM-CSF, Cox 2, IL-8, E-selectin, and tissue factor (13-16).


Figure 6
View larger version (9K):
[in this window]
[in a new window]
  		FIGURE 6. Schematic diagram of proposed mechanisms for DSCR1-1L and DSCR1-4 regulation of angiogenesis.

 
How do the proangiogenic effects of DSCR1-1L fit into this model? The calcineurin-NFAT axis is apparently involved because cyclosporin A, a calcineurin inhibitor, prevented PT67/FD1L cells from inducing angiogenesis in Matrigel plugs (Fig. 4D). Also, using a luciferase reporter assay, NFATc1 activity was increased in FD1L cells (HUVEC transfected with DSCR1-1L), either in the presence or absence of VEGF-A165, and VEGF-A165-mediated activity of NFATc1 was depressed when HUVEC were transfected with D1Si (Fig. 5A). Furthermore, NFAT activation was strongly inhibited in FD4 cells that overexpressed DSCR1-4 (Fig. 5A). In addition, experiments from Drosophila indicate that phosphorylation of RCN1, an orthologue of MCIP1/DSCR1, enhances calcineurin activity (34); these data support our findings that the DSCR1 gene can both inhibit and activate calcineurin.

Remaining to be elucidated is the signaling pathway by which VEGF-A165 induces DSCR1-1L expression. Unlike DSCR1-4, DSCR1-1L is not likely to be induced through the calcineurin-NFAT pathway (13-16). Whereas the promoter regulating DSCR1-4 is found in the intron preceding exon 4 and contains NFAT binding sites (34), the promoter regulating DSCR1-1L lies upstream of exon 1 and lacks NFAT binding sites (our unpublished data). Also remaining to be investigated are the mechanisms regulating the interplay between DSCR1-1L and DSCR1-4 signaling that determine whether angiogenesis is induced or inhibited. In the only experiment in which both of these isoforms were introduced into Matrigel (Fig. 4B, lane 4), the net effect was inhibition of angiogenesis.

DSCR1-1L was overlooked in earlier studies of VEGF-A-mediated regulation of DSCR1 function, likely for technical reasons that may have included the source of cultured cells, differences in serum starvation conditions (0.5% versus 0.1% serum), plate coatings (fibronectin versus collagen), etc. This would not be the first time that apparently minor differences in tissue culture technique have profoundly affected VEGF-A165 signaling. For example, plating HUVEC on collagen or fibronectin determined whether PLC{gamma} or phosphatidylinositol-3-kinase was required for VEGF-A165-stimulated HUVEC proliferation (23). Also, DSCR1-1L is expressed at much lower levels than DSCR1-4 in HUVEC and HMDVEC and its expression at both mRNA and protein levels was less stimulated by VEGF-A165 in these cultured cells (Fig. 1A and B). Nonetheless, although undetectable in the microvasculature of several normal tissues, DSCR1-1L was strongly expressed in vivo in the angiogenic responses induced by Ad-mVEGF-A164 and by mouse and human ovarian cancers (Fig. 2).

In summary, DSCR1-1L and DSCR1-4 represent distinct isoforms of the same gene that are regulated by different promoters and that have opposite effects on VEGF-A164/5-induced angiogenesis. How these conflicting activities are balanced in tumor angiogenesis in vivo remains to be determined. The possibilities include differential promoter regulation, expression levels, timing of expression, interacting proteins, etc., questions we are now addressing. The expression of different DSCR1 isoforms by different types of tumors could explain the puzzling findings that, in patients with Down syndrome, the incidence of certain types of malignancy is increased, whereas that of others is decreased (9-12). In any event, DSCR1-1L should be considered as a possible target for the therapeutic regulation of pathologic angiogenesis.


   Materials and Methods
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
References
 
Materials
Rat anti-mCD31 antibody and mouse anti-hCD31 antibody were obtained from BD Biosciences (BD Biosciences, PharMingen, San Diego, CA) and Dako (Carpinteria, CA), respectively. Anti-KDR antibody and anti-phosphorylated tyrosine (p-PY20) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Mouse monoclonal antibodies against human DSCR1 (all isoforms, hDSCR1), against specific human DSCR1 isoforms (hDSCR1-1, hDSCR1-3, and hDSCR1-4), and against mouse DSCR1 (all isoforms, mDSCR1) were obtained from the Center for Biomedical Inventions, University of Texas Southwestern Medical School and from Abnova Corporation (Taipei, Taiwan, ROC). Flag antibody was from Sigma-Aldrich (St. Louis, MO).

Cell Culture and Assays
HUVECs (Clonetics, Biowhittaker, Inc., Walkersville, MD) were cultured and transduced with retroviruses carrying various constructs as previously described (23). HMDVECs were isolated from newborn foreskins (35) and were cultured in EBM medium. At 80% confluence, HUVEC and HMDVEC were incubated in 0.1% fetal bovine serum–containing EBM medium for 24 hours and then treated with VEGF-A165 (10 ng/mL) for different times and subjected to proliferation assays as previously described (23).

Reverse Transcription-PCR Analyses
RNA was isolated from HUVEC that had been serum-starved for 24 hours and stimulated with 10 ng/mL of VEGF-A for the times indicated. RT-PCR with isoform-specific primers was carried out as described (17). Glyceraldehyde-3-phosphate dehydrogenase served as a control for equal RNA loading. RT-PCR products were analyzed on 4% agarose gels. Experiments were repeated thrice.

In vivo Angiogenesis Models
Female, 4- to 5-week-old nu/nu mice (NIH) were injected i.d. in ear skin with 1 x 108 plaque-forming units of adenoviral vectors expressing either mouse VEGF-A164 (Ad-mVEGF-A164) or, as a control, Ad-LacZ (22). MOT cells were maintained by i.p. passage in C3H/HeJ mice and 106 cells were injected i.p. for growth in ascites form as previously described (36). Ears and mesenteries were homogenized in T-PER tissue protein extraction reagent (Pierce Biotechnology, Inc. Rockford, IL) or in RNA extraction buffer (Qiagen, Inc., Valencia, CA). Equal amounts of protein were subjected to immunoblotting using the mDSCR1 antibody. RNA was isolated and subjected to RT-PCR with DSCR1-1L- or DSCR1-4–specific primers. Experiments were repeated thrice.

Human Ovarian Carcinomas
Tumors were obtained at the time of surgery and were fixed in 4% paraformaldehyde, embedded in OCT compound and prepared for immunohistochemistry (see below). These experiments were carried out according to a protocol approved by the hospital's Committee on Clinical Investigation.

Immunohistochemistry
Implanted Matrigel plugs were dissected free, fixed in 4% paraformaldehyde for 4 hours, changed to 30% sucrose overnight, and embedded in OCT compound. Frozen sections were then blocked with 5% goat serum and stained with the following primary antibodies at room temperature for 1 hour: rat anti-mCD31 antibody (1:50 dilution; BD Biosciences, PharMingen), mouse anti-hCD31 (1:100 dilution, Dako), or mouse anti-hDSCR1-1L, mouse anti-hDSCR1-4, mouse anti-mDSCR1, all at 1:100 dilution (Center for Biomedical Inventions, University of Texas Southwestern Medical School). Sections were then washed thrice with PBS and incubated for 1 hour with appropriate secondary antibodies: biotinylated polyclonal anti-rat IgG antibody (1:500 dilution) or biotinylated polyclonal anti-mouse IgG antibody (1:200 dilution; Vector Laboratories, Inc. Burlingame, CA). Sections were then washed thrice with PBS, reacted with the ABC peroxidase kit (Vector Laboratories) at room temperature for 45 minutes, and washed twice with PBS prior to mounting for light microscopy and photography.

Cloning and Expression of DSCR1 Isoforms and siRNAs
DSCR1 isoforms were cloned by RT-PCR using RNA isolated from HUVEC cultured for 1 hour with 10 ng/mL of VEGF-A165. The 5' primers are listed below: DSCR1-1, ATGGAGGAGG TGGACCTGCAGG; DSCR1-1L, CTGATGGAGGACGGCGTGGCCGG; DSCR1-3, ATGGTGTATGC CAAATTTGAGTCC; DSCR1-4, ATGCATTTTAGAAACTTTAACTAC. The 3' primer was TCAGCTG AGGTGGATCGGCGTGTAC. The identities of the PCR fragments were confirmed by DNA sequencing. The cDNAs were fused in-frame to the Flag sequence, cloned into the retroviral vector pMMP, and overexpressed in HUVEC as described previously (23).

Recently, a new vector system, pSUPER-retro, was used to direct the synthesis of siRNAs in mammalian cells. Sequence-specific siRNAs destroy the endogenous mRNAs that match the siRNA sequence, thus inhibiting the expression of their cognate protein (37). siRNAs were designed with the software from OligoEngine, Co. (Seattle, WA), cloned into pSUPER-retro vector (OligoEngine), and expressed in HUVEC. The D1Si and D4Si sequences were GCTTCATTGACTGCGAGA and CCAGGGCCAAATTTGAGTC, respectively. Neg-Si is the scrambled sequence of D4Si. The Neg-Si is GAACAAATACGCGTGTGTC.

Matrigel Angiogenesis Assays
Matrigel angiogenesis assays were carried out as described (25). SKMEL/VEGF cells (1 x 107), alone or mixed with 1 x 107 of PT67 cells infected with retroviruses expressing various full-length DSCR1 or LacZ cDNAs or DSCR1 isoform–specific siRNAs were suspended in 0.5 mL of growth factor–reduced Matrigel (BD Biosciences, Bedford, MA) and injected s.c. into nu/nu mice. Tissues were harvested, photographed, and fixed with 4% paraformaldehyde for immunohistochemistry. In some experiments, the KDR inhibitor SU1498 (Calbiochem, San Diego, CA) or the calcineurin inhibitor, cyclosporine A (Sigma), was incorporated into Matrigel plugs (40 µg/mL Matrigel) and was also injected i.p. daily (1 mg/kg) after Matrigel implantation. Each experiment was replicated on eight mice.

Quantitative Analysis of Plasma Volumes in Matrigel Assays
These assays were carried out as described (25). Mice (four per group) implanted with various cell combinations in Matrigel were anesthetized with Avertin (tribromoethanol, 200 mg/kg) and injected i.v. via the tail vein with 0.2 mL of Evan's blue dye (5 mg/mL in saline). After 5 minutes, blood was collected in heparin by cardiac puncture and centrifuged at 14,000 rpm for 10 minutes to obtain platelet-poor plasma which was diluted in formamide for the measurement of Evan's blue dye concentration. Animals were euthanized by carbon dioxide narcosis and Matrigel plugs were dissected free by cautery to prevent blood loss, weighed, and extracted with 2 mL of formamide at room temperature for 3 days. Dye in plasma or extracted from Matrigels was measured at 620 nmol/L in a Thermo Max microplate reader (Molecular Devices, Menlo Park, CA) using Softmax 881 software. Standard curves were generated by the measurement of serial dilutions of Evan's blue dye in formamide (µg/mL). Intravascular plasma volumes (µL/g Matrigel) were calculated on the basis of Evan's blue dye concentrations in blood plasma to provide an absolute measure of the volume of plasma in the vascular bed.

NFAT Targeted Promoter Luciferase Assay
HUVEC transduced with various constructs were seeded in 12-well plates at 1 x 106 cells/well. Twenty hours later, cells were transfected with NFAT-targeted promoter-luciferase plasmid (pGL3 NFAT-Luc) and control luciferase plasmid (pRL-Tk-Luc) with FuGENE6 transfection reagent (Roche Diagnostics, Indianapolis, IN). Cells were washed twice with PBS. Two microliters of Fugene were added directly to 50 µL of OPTI-MEM1 medium and incubated at room temperature for 5 minutes. NFAT-luc plasmid (0.75 µg) and pRL-Tk (0.15 µg) were added to the mixture and incubated at room temperature for 15 minutes, and then added to cells with 300 µL of medium. Twenty-four hours later, cells were changed to EBM medium with 0.1% fetal bovine serum. After 24 hours, cells were stimulated with 10 ng/mL of VEGF-A165 for 6 hours. Cells were washed twice with PBS and incubated with 120 µL of passive buffer from a dual-luciferase reporter Assay system (Promega, Madison, WI) at room temperature until cells were dissolved. Luciferase activity was assayed according to the manufacturer's protocol.

Animal Welfare
All animal experiments were done in compliance with the Beth Israel Deaconess Medical Center's Animal Care and Use Committee.

Statistics
ANOVA and the Tukey-Kramer multiple comparisons test were used to determine statistical significance.


   Notes
Top
 Notes
Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Grant support: NIH grant K01 CA098581 and ACS grant RSG-05-118-01-CSM (H. Zeng); K01 DK064920-01A1 (D. Zhao), and HL-59316 and P01 CA-92644 (H.F. Dvorak).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/).

L. Qin and D. Zhao contributed equally to this work.

Received 5/ 8/06; revised 8/ 9/06; accepted 8/21/06.


   References
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Hassold TJ, Jacobs PA. Trisomy in man. Annu Rev Genet 1984;18:69–97.[CrossRef][Medline]
  2. Fuentes JJ, Pritchard MA, Estivill X. Genomic organization, alternative splicing, and expression patterns of the DSCR1 (Down syndrome candidate region 1) gene. Genomics 1997;44:358–61.[CrossRef][Medline]
  3. Fuentes JJ, Pritchard MA, Planas AM, Bosch A, Ferrer I, Estivill X. A new human gene from the Down syndrome critical region encodes a proline-rich protein highly expressed in fetal brain and heart. Hum Mol Genet 1995;4:1935–44.[Abstract/Free Full Text]
  4. Rothermel B, Vega RB, Yang J, Wu H, Bassel-Duby R, Williams RS. A protein encoded within the Down syndrome critical region is enriched in striated muscles and inhibits calcineurin signaling. J Biol Chem 2000;275:8719–25.[Abstract/Free Full Text]
  5. Crawford DR, Leahy KP, Abramova N, Lan L, Wang Y, Davies KJ. Hamster adapt78 mRNA is a Down syndrome critical region homologue that is inducible by oxidative stress. Arch Biochem Biophys 1997;342:6–12.[CrossRef][Medline]
  6. Leahy KP, Davies KJ, Dull M, Kort JJ, Lawrence KW, Crawford DR. adapt78, a stress-inducible mRNA, is related to the glucose-regulated protein family of genes. Arch Biochem Biophys 1999;368:67–74.[CrossRef][Medline]
  7. Ermak G, Morgan TE, Davies KJ. Chronic overexpression of the calcineurin inhibitory gene DSCR1 (Adapt78) is associated with Alzheimer's disease. J Biol Chem 2001;276:38787–94.[Abstract/Free Full Text]
  8. Gorlach J, Fox DS, Cutler NS, Cox GM, Perfect JR, Heitman J. Identification and characterization of a highly conserved calcineurin binding protein, CBP1/calcipressin, in Cryptococcus neoformans. EMBO J 2000;19:3618–29.[CrossRef][Medline]
  9. Hasle H. Pattern of malignant disorders in individuals with Down's syndrome. Lancet Oncol 2001;2:429–36.[CrossRef][Medline]
  10. Smucker JD, Roth LM, Sutton GP, Hurteau JA. Trisomy 21 associated with ovarian dysgerminoma. Gynecol Oncol 1999;74:512–4.[Medline]
  11. Faruqi SA, Noumoff MJ, Deger RB, Jalal SM, Antoniades K. Trisomy 21 as the only recurrent chromosomal anomaly in a clinically aggressive ovarian carcinoma. Cancer Genet Cytogenet 2002;138:165–8.[Medline]
  12. Verhest A, Nedoszytko B, Noel J, Simon P, Limon J. Granulosa cell tumors of the ovary: a karyotypic analysis. Fourth International Workshop on Chromosomes in Solid Tumors 1991; Abstract no. B24.
  13. Liu D, Jia H, Holmes DI, Stannard A, Zachary I. Vascular endothelial growth factor-regulated gene expression in endothelial cells: KDR-mediated induction of Egr3 and the related nuclear receptors Nur77, Nurr1, and Nor1. Arterioscler Thromb Vasc Biol 2003;23:2002–7.[Abstract/Free Full Text]
  14. Minami T, Horiuchi K, Miura M, et al. VEGF- and thrombin-induced termination factor, down syndrome critical region-1, attenuates endothelial cell proliferation, and angiogenesis. J Biol Chem 2004;279:50537–54.[Abstract/Free Full Text]
  15. Yao YG, Duh EJ. VEGF selectively induces Down syndrome critical region 1 gene expression in endothelial cells: a mechanism for feedback regulation of angiogenesis? Biochem Biophys Res Commun 2004;321:648–56.[CrossRef][Medline]
  16. Hesser BA, Liang XH, Camenisch G, et al. Down syndrome critical region protein1 (DSCR1), a novel VEGF target gene that regulates expression of inflammatory markers on activated endothelial cells. Blood 2004;104:149–58.[Abstract/Free Full Text]
  17. Ermak G, Harris CD, Davies KJ. The DSCR1 (Adapt78) isoform 1 protein calcipressin 1 inhibits calcineurin and protects against acute calcium-mediated stress damage, including transient oxidative stress. FASEB J 2002;16:814–24.[Abstract/Free Full Text]
  18. Genesca L, Aubareda A, Fuentes JJ, Estivill X, De La Luna S, Perez-Riba M. Phosphorylation of calcipressin 1 increases its ability to inhibit calcineurin and decreases calcipressin half-life. Biochem J 2003;374:567–75.[CrossRef][Medline]
  19. Molkentin JD, Lu JR, Antos CL, et al. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 1998;93:215–28.[CrossRef][Medline]
  20. Musaro A, McCullagh KJ, Naya FJ, Olson EN, Rosenthal N. IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association with GATA-2 and NF-ATc1. Nature 1999;400:581–5.[CrossRef][Medline]
  21. Semsarian C, Wu MJ, Ju YK, et al. Skeletal muscle hypertrophy is mediated by a Ca2+-dependent calcineurin signalling pathway. Nature 1999;400:576–81.[CrossRef][Medline]
  22. Pettersson A, Nagy JA, Brown LF, et al. Heterogeneity of the angiogenic response induced in different normal adult tissues by vascular permeability factor/vascular endothelial growth factor. Lab Invest 2000;80:99–115.[Medline]
  23. Zeng H, Dvorak HF, Mukhopadhyay D. Vascular permeability factor (VPF)/vascular endothelial growth factor (VEGF) peceptor-1 down-modulates VPF/VEGF receptor-2-mediated endothelial cell proliferation, but not migration, through phosphatidylinositol 3-kinase-dependent pathways. J Biol Chem 2001;276:26969–79.[Abstract/Free Full Text]
  24. Roche E, Buteau J, Aniento I, Reig JA, Soria B, Prentki M. Palmitate and oleate induce the immediate-early response genes c-fos and nur-77 in the pancreatic ß-cell line INS-1. Diabetes 1999;48:2007–14.[Abstract]
  25. Zeng H, Qin L, Zhao D, et al. Orphan nuclear receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. J Exp Med 2006;203:719–29.[Abstract/Free Full Text]
  26. Hoang MV, Senger DR. In vivo and in vitro models of mammalian angiogenesis. Methods Mol Biol 2005;294:269–85.[Medline]
  27. Hoang MV, Whelan MC, Senger DR. Rho activity critically and selectively regulates endothelial cell organization during angiogenesis. Proc Natl Acad Sci U S A 2004;101:1874–9.[Abstract/Free Full Text]
  28. Underiner TL, Ruggeri B, Gingrich DE. Development of vascular endothelial growth factor receptor (VEGFR) kinase inhibitors as anti-angiogenic agents in cancer therapy. Curr Med Chem 2004;11:731–45.[CrossRef][Medline]
  29. Nagy J, Feng D, Vasile E, et al. Permeability properties of tumor surrogate blood vessels induced by VEGF-A. Lab Invest 2006;86:767–80.[Medline]
  30. Vega RB, Yang J, Rothermel BA, Bassel-Duby R, Williams RS. Multiple domains of MCIP1 contribute to inhibition of calcineurin activity. J Biol Chem 2002;277:30401–7.[Abstract/Free Full Text]
  31. Hilioti Z, Gallagher DA, Low-Nam ST, et al. GSK-3 kinases enhance calcineurin signaling by phosphorylation of RCNs. Genes Dev 2004;18:35–47.[Abstract/Free Full Text]
  32. Armesilla AL, Lorenzo E, Gomez del Arco P, Martinez-Martinez S, Alfranca A, Redondo JM. Vascular endothelial growth factor activates nuclear factor of activated T cells in human endothelial cells: a role for tissue factor gene expression. Mol Cell Biol 1999;19:2032–43.[Abstract/Free Full Text]
  33. Iizuka M, Abe M, Shiiba K, Sasaki I, Sato Y. Down syndrome candidate region 1, a downstream target of VEGF, participates in endothelial cell migration and angiogenesis. J Vasc Res 2004;41:334–44.[CrossRef][Medline]
  34. Fuentes JJ, Genesca L, Kingsbury TJ, et al. DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated signaling pathways. Hum Mol Genet 2000;9:1681–90.[Abstract/Free Full Text]
  35. Richard L, Velasco P, Detmar M. A simple immunomagnetic protocol for the selective isolation and long-term culture of human dermal microvascular endothelial cells. Exp Cell Res 1998;240:1–6.[CrossRef][Medline]
  36. Nagy JA, Masse EM, Herzberg KT, et al. Pathogenesis of ascites tumor growth: vascular permeability factor, vascular hyperpermeability, and ascites fluid accumulation. Cancer Res 1995;55:360–8.[Abstract/Free Full Text]
  37. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550–3.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
X. Liu, D. Zhao, L. Qin, J. Li, and H. Zeng
Transcription Enhancer Factor 3 (TEF3) Mediates the Expression of Down Syndrome Candidate Region 1 Isoform 1 (DSCR1-1L) in Endothelial Cells
J. Biol. Chem., December 5, 2008; 283(49): 34159 - 34167.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. Wang, X. Li, M. Parra, E. Verdin, R. Bassel-Duby, and E. N. Olson
Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase 7
PNAS, June 3, 2008; 105(22): 7738 - 7743.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. Waldeck-Weiermair, C. Zoratti, K. Osibow, N. Balenga, E. Goessnitzer, M. Waldhoer, R. Malli, and W. F. Graier
Integrin clustering enables anandamide-induced Ca2+ signaling in endothelial cells via GPR55 by protection against CB1-receptor-triggered repression
J. Cell Sci., May 15, 2008; 121(10): 1704 - 1717.
[Abstract] [Full Text] [PDF]

Home page
 PediatricsHome page
A. K. Greene, S. Kim, G. F. Rogers, S. J. Fishman, B. R. Olsen, and J. B. Mulliken
Risk of Vascular Anomalies With Down Syndrome
Pediatrics, January 1, 2008; 121(1): e135 - e140.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. R. Bush, J. M. Havens, B. M. Necela, W. Su, L. Chen, M. Yanagisawa, P. Z. Anastasiadis, R. Guerra, B. A. Luxon, and E. A. Thompson
Functional Genomic Analysis Reveals Cross-talk between Peroxisome Proliferator-activated Receptor {gamma} and Calcium Signaling in Human Colorectal Cancer Cells
J. Biol. Chem., August 10, 2007; 282(32): 23387 - 23401.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qin, L.
Right arrow Articles by Zeng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qin, L.
Right arrow Articles by Zeng, H.

HOME HELP FEEDBACK SUBSCRIPTIONS