Molecular Cancer Research Holland CR Podcast
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buck, A.
Right arrow Articles by Ellenrieder, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buck, A.
Right arrow Articles by Ellenrieder, V.
Molecular Cancer Research 4:861-872 (2006)
© 2006 American Association for Cancer Research


Signaling and Regulation

The Tumor Suppressor KLF11 Mediates a Novel Mechanism in Transforming Growth Factor ß–Induced Growth Inhibition That Is Inactivated in Pancreatic Cancer

Anita Buck1, Malte Buchholz1, Martin Wagner1, Guido Adler1, Thomas Gress1,2 and Volker Ellenrieder1,2

1 Department of Internal Medicine I, University of Ulm, Germany and 2 Department of Internal Medicine, Division of Gastroenterology and Endocrinology, University of Marburg, Marburg, Germany

Requests for reprints: Volker Ellenrieder, Innere Medizin, SP Gastroenterologie, Baldingerstraße, 35043 Marburg, Germany. Phone: 49-6421-286-2318; Fax: 49-6421-286-8922. E-mail: ellenrie{at}med.uni-marburg.de


    Abstract
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
c-myc promoter silencing is a key step in epithelial cell growth inhibition by transforming growth factor ß (TGFß). During carcinogenesis, however, epithelial cells escape from c-myc repression and consequently become refractory to TGFß-mediated antiproliferation. Here, we assessed the role of the repressor, KLF11, in TGFß-induced growth inhibition in normal epithelial as well as pancreatic carcinoma cells. Endogenous KLF11 was stably down-regulated by RNA interference technology, and the functional consequences were studied by proliferation assays, reporter assays, DNA binding studies, and expression analyses. Coimmunoprecipitation and glutathione S-transferase pulldown assays were conducted to define KLF11-Smad3 interaction and U0126 was administered to examine the effects of the extracellular signal-regulated kinase (ERK)–mitogen-activated protein kinase on complex formation and c-myc promoter binding of KLF11 and Smad3 in pancreatic cancer cells. In TGFß-stimulated normal epithelial cells, nuclear KLF11, in concert with Smad3, binds to and represses transcription from the core region of the TGFß-inhibitory element (TIE) of the c-myc promoter. Disruption of KLF11-Smad3 interaction or small interfering RNA–mediated knockdown of endogenous KLF11 strongly diminishes Smad3-TIE promoter binding and repression, and consequently impairs TGFß-mediated growth inhibition. In pancreatic cancer cells with oncogenic Ras mutations, hyperactive ERK counteracts TGFß-induced c-myc repression and growth inhibition through at least two mechanisms, i.e., via disruption of KLF11-Smad3 complex formation and through inhibition of KLF11-Smad3 binding to the TIE element. Together, these results suggest a central role for KLF11 in TGFß-induced c-myc repression and antiproliferation and identifies a novel mechanism through which ERK signaling antagonizes the tumor suppressor activities of TGFß in pancreatic cancer cells with oncogenic Ras mutations. (Mol Cancer Res 2006;4(11):861–72)


    Introduction
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Transforming growth factor ß (TGFß) is a multifunctional cytokine which controls a plethora of cellular functions through both transcriptional activation and repression of immediate target genes (1, 2). The growth-inhibitory effects of TGFß are primarily based on its ability to inhibit G1-S phase cell cycle transition and are defined by two major events, i.e., the repression of the proto-oncogene, c-myc, and the subsequent activation of the cyclin-dependent kinase inhibitors, p15Ink4b and p21Cip1 (3, 4). In the absence of TGFß, c-myc partners with the zinc finger protein Miz-1 to bind the transcription initiator element of the p15Ink4b promoter, thus, inhibiting the expression of the p15Ink4b cell cycle regulator and promoting cell cycle progression (5). In response to TGFß, however, c-myc expression levels decrease rapidly resulting in the relief of p15Ink4b expression and cell cycle arrest (6). Thus, transcriptional repression of c-myc is a key event in TGFß growth control.

TGFß controls gene transcription through receptor-mediated activation of the Smad proteins—transcription factors that transmit the signal from the cell surface to the nucleus. The TGFß receptor consists of a heteromeric type I—type II receptor complex with serine-threonine activity (7, 8). Activated type I receptor phosphorylates Smad2 and Smad3, which releases them from cytoplasmic anchors, allowing their translocation into the nucleus and association with the related factor, Smad4. In the nucleus, the activated Smad complex recognizes regulatory elements in target gene promoters and, in conjunction with associated site-specific transcription factors, regulates the transcriptional response to TGFß (9, 10). Numerous transcription factors have been identified which act as Smad partner proteins in the activation of TGFß response genes, including members of the activator protein family, Sp1 and Ets-2 (11). In contrast, information on partnering transcription factors which actively participate in the repression of genes down-regulated by TGFß signaling, such as c-myc, has remained scarce.

There is increasing evidence that a group of transcriptional repressors, which are themselves inducible by TGFß signaling, may play an important part in TGFß-mediated gene silencing (12-15). One of these is KLF11 (also termed TIEG2 or FKLF), a zinc finger protein which is ubiquitously expressed in human tissues, with the highest levels found in healthy pancreas (13). When artificially overexpressed in carcinoma cell lines, KLF11 has been shown to exert tumor suppressor functions through its potential to suppress epithelial cell growth (16, 17). First evidence for a role of KLF11 in TGFß-regulated gene expression was recently presented by our group, demonstrating that KLF11 potentiates Smad-signaling activity through termination of the negative feedback loop imposed by Smad7 (18). Interestingly, however, recent findings also suggested that the repressor function of KLF11 might be impaired in pancreatic cancer cells with oncogenic extracellular signal-regulated kinase (ERK) signaling, coinciding with the failure of these cells to react to TGFß treatment with growth inhibition. We therefore decided to investigate whether KLF11 directly participates in TGFß-induced growth inhibition and c-myc repression and, if so, whether this function is disturbed in pancreatic cancer cells.


    Results
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Knockdown of KLF11 Abolishes TGFß-Induced Growth Inhibition and c-myc Repression
To investigate the mechanisms of TGFß-mediated antiproliferation in normal epithelial cells, we did cell proliferation studies in three epithelial cell lines which had previously been shown to exhibit strong growth-inhibitory responses to TGFß. MCF-10A and EpH4 cells were originally derived from normal human or mouse mammary tissues, respectively, and HEK-293 cells were isolated from a human embryonic kidney (19, 20). In accordance with previous reports, TGFß strongly inhibited cell proliferation in all three cell lines (Fig. 1A ), accompanied by a rapid and significant down-regulation of c-myc mRNA expression (Fig. 1B). To elucidate whether KLF11 is potentially involved in these important TGFß functions, we knocked-down endogenous KLF11 expression by generating HEK-293 cells stably transfected with vectors expressing short hairpin/short interference RNAs specifically directed against human KLF11 mRNA (pSilencerKLF11) or non-silencing control short hairpin RNAs (pSilencerns). Successful down-regulation of KLF11 mRNA expression was confirmed in three independent cell clones (clone 1, 2, and 3) by real-time PCR (data not shown) and Northern blot analysis (Fig. 2A ). Similar to the effects of TGFß on cell proliferation in untransfected HEK-293 cells (Fig. 1A), TGFß suppressed cell growth in cells stably transfected with the non-silencing control vector (pSilencerns; Fig. 2B). However, TGFß failed to inhibit growth in HEK-293 cells upon depletion of KLF11, as shown for clone 1 (Fig. 2B). Similar, although a little less pronounced, results were obtained for pSilencerKLF11 clones 2 and 3 as well as for MCF-10A cells transiently transfected with small interfering RNA against KLF11 (data not shown). Furthermore, TGFß treatment resulted in significant down-regulation of c-myc mRNA levels in TGFß-responsive pSilencerns control cells, but not in KLF11 knockdown cells (Fig. 2C), indicating that the presence of KLF11 is required for sufficient repression of c-myc by TGFß.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. TGFß induces cell growth inhibition and represses c-myc mRNA expression in normal epithelial cells. A. TGFß inhibits the cell growth of normal epithelial cells. Proliferation assays were done in HEK-293, MCF-10A, and EpH4 cells upon treatment with TGFß (5 ng/mL) for 24 hours. B. TGFß represses c-myc mRNA expression in normal epithelial cells. HEK-293, MCF-10A, and EpH4 cells were treated for 3 hours with TGFß (5 ng/mL) or left untreated before harvesting. c-myc mRNA expression was examined by Northern blot analysis. The 28S-rRNA ethidium bromide band was included to control for loading.

 

Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Knockdown of KLF11 abolishes TGFß-induced growth inhibition and c-myc repression. A. Generation of HEK-293 cells stably transfected with vectors expressing short hairpin/short interference RNAs specifically directed against human KLF11 mRNA (pSilencerKLF11) or non-silencing control short hairpin RNAs (pSilencerns). KLF11 mRNA expression was determined by Northern blot analysis and is shown for vector control clones (pSilencerns; clones 1 and 2) and KLF11 knockdown clones (pSilencerKLF11; clones 1, 2, and 3). The 28S-rRNA ethidium bromide band is shown for loading controls. B. Knockdown of endogenous KLF11 expression reduces TGFß-induced cell growth inhibition. Proliferation assays were done in HEK-293 cells stably transfected with either pSilencerns control vector (clone 1) or pSilencerKLF11 (clone 1). Cells were incubated in medium and either left untreated or treated with the additional substitution of 5 ng/mL of TGFß for 24 hours. C. Endogenous KLF11 expression is required for TGFß-induced inhibition of c-myc mRNA expression. Northern blot analyses were carried out using RNA from pSilencerns or pSilencerKLF11 stably transfected cell clones following treatment with 5 ng/mL of TGFß for 3 hours. The 28S-rRNA ethidium bromide band is shown for loading controls. D. TGFß-induced repression of the human c-myc promoter is significantly reduced upon knockdown of endogenous KLF11 expression. pSilencerns and pSilencerKLF11 cell clones were transiently transfected with a reporter gene construct containing the full-length (2,780 bp) c-myc promoter sequence. TGFß signaling was induced by cotransfection of a constitutively activated TGFß type I receptor (TßRI c.a.). Luciferase activity was measured and basal Myc-wt values (in the absence of TGFß) were arbitrarily set to 1 for each individual clone. Columns, mean from three independent experiments; bars, ±SD.

 
Recent reports have convincingly shown that TGFß primarily down-regulates c-myc expression on the level of promoter regulation (22). To examine whether KLF11 plays a role in this process, we did reporter gene assays in KLF11-depleted HEK-293 cells (pSilencerKLF11) as well as control cells (pSilencerns) using a 2.7-kb spanning human c-myc promoter reporter construct (Myc-wt, –2446 to + 334; Fig. 2D). Activation of the TGFß signaling pathway strongly inhibited transcription from the c-myc promoter in KLF11-expressing cells (pSilencerns) but not in cells in which KLF11 expression was successfully knocked-down (pSilencerKLF11). Thus, these results showed the critical role of KLF11 in TGFß-induced c-myc repression and growth inhibition, and suggested that KLF11 expression is required for silencing of the c-myc promoter in response to TGFß.

KLF11 Binds to and Represses Transcription from the TGFß-Inhibitory Element Core Region of the c-myc Promoter
TGFß inhibits transcription from the c-myc promoter particularly through repression of a 14-bp spanning region within the proximal human c-myc promoter (GGCTTGGCGGGAAA, –84 to –72 relative to the P2 transcription start site; Fig. 3A ). This promoter region, termed TGFß-inhibitory element (TIE), closely conforms to the TIE sequence within the human stromelysin-1 promoter (21). We have analyzed the relevance of KLF11 in TGFß-mediated repression of the TIE element and transfected KLF11 knockdown cells (pSilencerKLF11) and control cells (pSilencerns) with a luciferase reporter plasmid containing the wild-type TIE sequence (TIE-wt) of the c-myc promoter. Similar to our observations on the full-length c-myc promoter, TGFß strongly suppressed transactivation of the TIE element in KLF11-expressing HEK-293 cells (pSilencerns) but not in KLF11-depleted cells (pSilencerKLF11), thus, indicating that KLF11 is involved in the silencing of the c-myc TIE element upon TGFß treatment (Fig. 3B). Detailed promoter studies have recently shown that the TGFß responsiveness of the TIE element is primarily mediated by the central TTGG core region, and that mutation of this sequence prevents the repression of the c-myc promoter by TGFß (22). To elucidate whether KLF11 is able to directly regulate transcription from the TIE core sequence, we transfected HEK-293 cells with full-length KLF11 along with reporter plasmids encoding for either wild-type TIE (TIE-wt) or core-mutated TIE (TIE-Mcore). Figure 3C shows that KLF11 inhibited transcription from the TIE–wild-type sequence but failed to repress the TIE element upon inactivation of the core sequence. This is also true for the full-length c-myc promoter, as shown in Fig. 3D. In detail, increased KLF11 expression resulted in a dose-dependent repression of the native human c-myc promoter (Myc-wt), whereas mutational disruption of the core sequence (Myc-Mcore) rendered the promoter insensitive to KLF11. We then investigated whether KLF11 directly interacts with the core region and did gel shift assays (electrophoretic mobility shift assay) using glutathione S-transferase (GST) fused KLF11 and 32P-labeled double-stranded oligonucleotide probes containing either the wild-type (TIE-wt) or core mutated TIE (TIE-Mcore; Fig. 3E). DNA binding of KLF11 was readily detectable using the wild-type TIE sequence (lane 3), whereas no binding was observed upon mutation of the TTGG core sequence (lane 4). In addition, we assessed KLF11-TIE binding by DNA pulldown assays using nuclear extracts from KLF11-transfected cells. DNA pulldown assays have particularly been used in previous studies to detect the interaction of TGFß-regulated transcriptional complexes with specific promoter elements such as the TIE element (22-24). Consistent with the gel shift experiments, DNA pulldown assays revealed that KLF11 abundantly bound to the wild-type TIE element but failed to show binding to the TIE-Mcore mutant (Fig. 3F). Taken together, our DNA binding studies and reporter gene assays identified the TIE element of the c-Myc promoter as a novel KLF11 target sequence and suggested that KLF11 represses the TIE element through interaction with the TTGG core region.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. KLF11 binds to and represses transcription from the TIE core region of the c-myc promoter. A. Sequence analysis of TIE within the proximal human c-myc promoter as inserted in the luciferase reporter plasmid (TIE-wt). Boxed, the TIE element; boldface letters, core sequence. The mutations introduced in the TIE core sequence and inserted in reporter plasmids (TIE-Mcore) are also shown. B. Endogenous KLF11 expression is necessary for TGFß-induced repression of the c-myc TIE. pSilencerns and pSilencerKLF11 cell clones were transiently transfected with TIE-wt along with constitutively activated TGFß type I receptor (TßRI c.a.). Basal levels in the absence of TßRI were arbitrarily set to 1 for each experiment. C. KLF11 represses the c-myc TIE promoter element. Cells were transiently transfected with KLF11 and reporter plasmids encoding for either the TIE wild-type element (TIE-wt) or a mutant form of the TIE in which the core sequence was inactivated (TIE-Mcore). Firefly luciferase activity was measured 24 hours post-transfection and normalized to Renilla luciferase controls. Basal levels in the absence of KLF11 were arbitrarily set to 1 for each experiment. Columns, mean from three independent experiments; bars, ±SD. KLF11 nicely represses the TIE wild-type element of the c-myc promoter but not the TIE mutant with a disrupted core region. D. KLF11 represses the TIE element in the context of the full-length c-myc promoter. Cells were transfected with either Myc-wt or Myc-Mcore reporter plasmids along with increasing amounts of KLF11. Basal levels in the absence of KLF11 were arbitrarily set to 1 for each experiment. E. KLF11 binds to the c-myc TIE element. Electrophoretic mobility shift assays were done to show in vitro binding of GST-KLF11 to the TIE element depending on the integrity of the TIE element. GST-KLF11 nicely bound the TIE wild-type sequence but failed to interact with the TIE element upon mutation of the TTGG core region (TIE-Mcore). F. DNA pulldown assays (DNAP) demonstrating specific KLF11 binding to the TIE element. Total cell lysates were incubated with biotinylated wild-type (wt) or mutant (Mcore) TIE oligonucleotides and protein-TIE complexes were isolated by streptavidin-agarose beads. TIE-bound KLF11 was detected by Western blot analyses.

 
KLF11 Cooperates with Smad3 in TGFß-Mediated TIE Repression
We next investigated whether the ability of KLF11 to repress the TIE core element is regulated by TGFß and whether this function involves an interaction with Smad3, the major player thus far identified in TGFß-induced TIE repression (25, 26). For this purpose, we transfected cells with TIE reporter constructs and studied the effect of TGFß treatment or Smad3 cotransfection on KLF11-mediated repression. Figure 4A and B summarize our findings and show that (a) TGFß treatment or individual overexpression of either KLF11 or Smad3 significantly lowered transcription from the TIE element, (b) combination of KLF11 and either TGFß treatment or Smad3 overexpression almost completely abrogated TIE reporter activity, and (c) mutational inactivation of the core sequence (TIE-Mcore) rendered the TIE element insensitive to KLF11, Smad3, and TGFß. These findings were substantiated by DNA pulldown assays demonstrating TGFß-induced binding of Smad3 and KLF11 to the TIE wild-type sequence but not to the TIE-Mcore sequence (Fig. 4C). We then went on and examined Smad3/KLF11 binding to the TIE core sequence in more detail. As depicted in Fig. 4D, the TTGG core sequence overlaps a previously identified Smad3 binding sequence (SBE) GCTT and a putative KLF11 binding site (KBE) GGCGGG. To investigate whether Smad3 and KLF11 cooperatively bind to their specific sites in response to TGFß, we conducted DNA pulldown using TIE mutant oligonucleotides in which the KLF11 and/or the Smad binding sites were disrupted (Fig. 4E). KLF11 binding to the TIE wild-type sequence increased upon TGFß treatment, whereas mutational inactivation of the KLF11 binding site completely abolished KLF11-TIE interaction. Similarly, the TIE wild-type element strongly precipitated endogenous Smad3 from TGFß-treated cells but not from untreated control cells or following mutation of the Smad binding site (TIE-SBEmut). The most striking result from these DNA pulldown experiments, however, was that Smad3 binding was also impaired by mutational inactivation of the KLF11 binding site (TIE-KBEmut). Consistently, reporter gene assays using wild-type or mutated TIE promoter constructs showed a dramatic reduction of TGFß-mediated TIE inhibition upon inactivation of either the Smad or the KLF11 binding sites (Fig. 4F). Together, these results strongly suggested that cooperative binding of KLF11 and Smad3 to their specific binding sites is required for sufficient repression of the c-myc promoter in response to TGFß.


Figure 4
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. KLF11 cooperates with Smad3 in TGFß-mediated TIE repression. A. Reporter gene assays were conducted to examine the effect of TGFß treatment on KLF11-mediated TIE repression. KLF11 was transiently transfected in MCF-10A cells along with either TIE-wt or TIE-Mcore. Twenty-four hours post-transfection, cells were treated with TGFß (5 ng/mL) or left untreated. Cells were lysed and luciferase activity was measured. Firefly luciferase activity was normalized to Renilla luciferase controls and basal levels were arbitrarily set to 1. KLF11-induced repression of the TIE element is significantly increased upon TGFß treatment. B. Smad3 and KLF11 cooperate in repression of the TIE. MCF-10A cells were transfected with the wild-type (TIE-wt) or mutated TIE (TIE-Mcore) along with KLF11, Smad3, or a combination of both transcription factors. Both factors work through the core region to synergistically repress the TIE promoter construct. Columns, mean from three independent experiments; bars, ±SD. C. Cooperative binding of KLF11 and Smad3 to the TIE element. HEK-293 cells were transiently transfected with FLAG-KLF11 and treated with or without TGFß. DNA pulldown experiments were done using wild-type (TIE-wt) or mutant (TIE-Mcore) biotinylated TIE oligonucleotides. The presence of KLF11 and endogenous Smad3 in the precipitates was detected by immunoblotting. D. Schematic representation of the putative KLF11 (KBE) and Smad3 (SBE) binding sites within the human c-myc TIE element. The KBE and SBE are marked and the mutants used for reporter assays and DNA pulldown binding studies are indicated. E. Cooperative binding of Smad3 and KLF11 to the TIE element. HEK-293 cells were transiently transfected with FLAG-KLF11 and treated with or without TGFß and subjected to DNA pulldown experiments. Wild-type (TIE-wt) or mutant (TIE-SBEmut, TIE-KBEmut, or TIE-SBE/KBEmut) biotinylated TIE oligonucleotides were used in DNA pulldown assays. The presence of FLAG-KLF11 and endogenous Smad3 in the precipitates was detected with anti-FLAG and specific anti-Smad3 antibodies. F. Loss of TGFß-induced repression upon mutation of KLF11 and Smad3 binding sites. HEK-293 cells were cotransfected with the indicated reporter plasmids along with a control vector or an expression plasmid encoding for constitutively activated TGFß type I receptor. Firefly luciferase activity was normalized to Renilla luciferase controls and basal levels in the absence of TßRI were arbitrarily set to 1 for each experiment. Columns, mean from three independent experiments; bars, ±SD.

 
KLF11 Physically Interacts with and Increases Binding of Smad3 to the TIE
To investigate whether the cooperative repression of the TIE involves a physical interaction between KLF11 and Smad3, we did coimmunoprecipitation studies using extracts from KLF11-transfected cells. Figure 5A shows that KLF11 rapidly interacted with endogenous Smad3 following TGFß treatment. To characterize this protein-protein interaction in more detail, we carried out GST pulldown experiments and incubated GST-KLF11 fragments containing either the proline-rich NH2-terminal repression domain (KLF11-NTD) or the highly conserved COOH-terminal zinc finger domain (KLF11-CTD) together with in vitro–translated Smad3. Figure 5B illustrates that KLF11 directly interacted with Smad3 via its COOH-terminal DNA binding domain. No interaction was observed between Smad3 and the NH2 terminus of KLF11. To examine whether this protein-protein interaction affects the ability of Smad3 to bind the TIE element, we carried out DNA pulldown assays. Figure 5C shows that TGFß-induced Smad3 binding to the TIE was substantially increased following introduction of either KLF11-FL or KLF11-CTD, but remained unaffected by KLF11-NTD, suggesting that interaction with the DNA-binding COOH-terminal domain of KLF11 might augment Smad3-TIE binding. We then went on to study whether this is indeed the case, and if so, whether KLF11-Smad3-TIE complex formation requires the integrity of the KLF11 binding site. For this purpose, we transfected HEK-293 cells with either Flag-Smad3 alone or together with KLF11-CTD before treatment with TGFß. Next, we did sequential immunoprecipitation to extract Smad3 from cell lysates and subsequently carried out DNA pulldown experiments to examine Smad3 and KLF11-CTD binding to the TIE (Fig. 5D, left). The results from these experiments revealed that (a) KLF11-CTD forms a complex with Smad3 on the TIE wild-type sequence, (b) simultaneous binding of KLF11-CTD increases the Smad3-TIE interaction, and (c) disruption of KLF11-TIE binding through mutation of the KLF11 binding site diminishes Smad3-TIE binding. Together, our DNA-binding studies clearly showed a critical role of KLF11 in Smad3-TIE binding and suggested that both the physical interaction of the TGFß-regulated transcription factors and the integrity of their specific promoter binding sites within the core region are required for sufficient repression of the TIE element in response to TGFß. In line with this conclusion, we found significantly reduced Smad3-TIE binding on knockdown of endogenous KLF11, as shown in Fig. 5F.


Figure 5
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. KLF11 physically interacts with and increases binding of Smad3 to the TIE. A. TGFß induces the physical interaction between Smad3 and KLF11. HEK-293 cells were transiently transfected with FLAG-KLF11 and were incubated in the presence or absence of 5 ng/mL of TGFß. After 1 hour, endogenous Smad3 was immunoprecipitated with anti-Smad3 antibodies and Smad3-bound KLF11 was detected by immunoblotting using anti-FLAG antibodies. Controls show similar KLF11 expression levels in lysates of TGFß-treated and untreated cells and show successful precipitation of Smad3. B. Binding to Smad3 is mediated by the COOH-terminal zinc finger domain of KLF11. Top, the functional domains of KLF11, as used for GST-pulldown studies. GST fusion proteins containing either the NH2-terminal repression domain (KLF11-NTD) or the COOH-terminal DNA binding zinc finger motifs (KLF11-CTD) were used for GST pulldown assays with in vitro–translated 35S-labeled Smad3. The amount of KLF11-bound Smad3 was determined by autoradiography and KLF11 was detected by immunoblotting using anti-GST antibodies. C. TGFß-induced binding of Smad3 to the c-myc TIE element is increased by cotransfection of KLF11-FL and KLF11-CTD. HEK-293 cells were transfected with FLAG-tagged parental vector, KLF11-FL, KLF11-NTD, or KLF11-CTD and treated with 5 ng/mL of TGFß for 1 hour. Equal amounts of total cell lysates were subjected to DNA pulldown assays using biotinylated wild-type TIE oligonucleotides. Endogenous Smad3 bound to the TIE was detected by immunoblotting using specific anti-Smad3 antibodies. D. HEK-293 cells were transfected with Flag-Smad3 alone or together with His-tagged KLF11-CTD and treated with TGFß. Cells were harvested and subjected to sequential immunoprecipitation, DNA pulldown, and immunoblotting analyses (left). Wild-type (TIE-wt) and mutant (TIE-KBEmut) biotinylated TIE oligonucleotides were used in the DNA pulldown. The presence of FLAG-Smad3 and His-KLF11-CTD in the DNA pulldown was detected with anti-FLAG or anti-His antibodies. E. Sufficient Smad3 binding to the c-myc TIE requires endogenous KLF11 expression. HEK 293 cells stably transfected with either pSilencerns control vector (clone 1) or pSilencerKLF11 (clones 1 and 3) were treated with TGFß for 1 hour or left untreated. Equal amounts of total cell lysates were incubated with biotinylated wild-type TIE oligonucleotides and precipitated by streptavidin-agarose beads. DNA affinity–purified precipitates or aliquots of total cellular lysates were subjected to immunoblot analysis using anti-Smad3 antibodies.

 
TGFß-Induced c-myc Repression and Growth Inhibition Is Lost in Pancreatic Cancer Cells
Escape from c-myc repression and TGFß-mediated growth inhibition is a typical event in carcinogenesis and results from either genetic or—more frequently—epigenetic alterations of TGFß-regulated transcription factors. Here, we studied whether pancreatic cancer cells escape TGFß-induced c-myc repression and growth inhibition and, if so, whether these alterations result from disturbed KLF11-Smad3 interaction. TGFß-mediated growth inhibition was studied in three pancreatic cancer cell lines with intact Smad signaling pathways (Panc-1, Suit-007, and Suit-028) and in one control cell line with homozygous deletion of the Smad4 gene (IMIM-PC-2; ref. 27). Pancreatic cancer cells were treated with TGFß for 24 hours and the effects of growth factor treatment on cell proliferation was measured by thymidine assays. As shown in Fig. 6A , cell proliferation remained unaffected by TGFß in all four tested cell lines, independent of the integrity of the Smad signaling pathway. Likewise, TGFß failed to repress endogenous c-myc mRNA expression in all four cell lines, as revealed by Northern blot analysis (Fig. 6B). We then elucidated whether impaired c-myc repression by TGFß reflects disturbed TIE promoter regulation and did reporter gene assays following transfection of the TIE-wt reporter plasmid and subsequent application of TGFß. Figure 6C shows that TGFß was indeed unable to repress the TIE wild-type promoter region in pancreatic cancer cells, again including those with intact Smad signaling pathway. These observations, together with our previous finding that KLF11 expression is not significantly altered in pancreatic cancer (18), prompted us to investigate whether escape from TGFß-induced c-myc repression and growth control might be the consequence of a functional inactivation of either KLF11 or Smad3 in pancreatic cancer cells.


Figure 6
View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 6. TGFß-induced c-myc repression and growth inhibition is lost in pancreatic cancer cells. A. Pancreatic cancer cells are refractory to TGFß-induced growth inhibition. IMIM PC-2, Panc-1, Suit-028, and Suit-007 cells were treated with TGFß (5 ng/mL). Twenty-four hours after transfection, proliferation was measured by thymidine incorporation. B. IMIM PC-2, Panc-1, Suit-028, and Suit-007 cells were treated with TGFß (5 ng/mL) for 3 hours or left untreated. The effects of TGFß on c-myc mRNA expression was investigated by Northern blot analysis. Endogenous c-myc mRNA expression levels remained unaffected by TGFß in all studied pancreatic cancer cell lines. 28S-rRNA is shown as a loading control. C. TGFß is unable to repress the c-myc TIE promoter element. IMIM PC-2, Panc-1, Suit-028, and Suit-007 cells were transfected with TIE-wt. Twenty-four hours post-transfection, cells were treated with TGFß for an additional 24 hours. Luciferase activity was measured and basal TIE-wt values in the absence of TGFß were arbitrarily set to 1 for each cell line.

 
Inhibition of ERK Restores TGFß-Induced Repression of the TIE Element
TGFß signaling and transcription is tightly controlled by a complex network of cellular mechanisms including crosstalk with oncogenic signaling cascades and tumor suppressor pathways (1, 11, 28). In the context of TGFß signaling in pancreatic cancer cells, the oncogenic Ras-Mek-ERK signaling cascade deserves particular attention because (a) activating K-Ras mutations are frequently found in pancreatic cancer and are also present in the pancreatic cancer cells used in this study (29-31), and (b) oncogenic K-Ras mutations frequently lead to constitutive activation of the downstream ERK-MAPK, which has been shown to be an effective antagonist of TGFß signaling (32). We therefore decided to study whether and how the Ras-Mek-ERK signaling pathway might interfere with TGFß-induced c-myc repression in pancreatic cancer cells.

Reporter gene assays showed that preincubation of Panc-1 cells with the Mek-inhibitor U0126 effectively restored the susceptibility of the TIE-wt promoter sequence to inhibition by TGFß (Fig. 7A ). Of note, U0126 did not substantially affect the TIE-wt promoter activity in the absence of TGFß. Similar results were obtained in Suit-028 and Suit-007 cells (data not shown). In line with these observations, down-regulation of endogenous c-myc mRNA expression by TGFß was restored in pancreatic cancer cells upon inhibition of endogenous ERK (Fig. 7B). We next examined whether ERK interferes with TGFß-stimulated nuclear translocation of Smad3, as has previously been shown in EpRas mammary epithelial cells overexpressing oncogenic H-Ras (32). Interestingly, however, our localization experiments revealed that TGFß rapidly and sufficiently induces nuclear translocation of Smad3 in pancreatic cancer cells (Fig. 7C, top). Moreover, as Smad translocation remained unaffected by pretreatment of cells with U0126, these experiments clearly indicated that loss of c-myc repression by TGFß is not caused by disturbed Smad signaling (Fig. 7C, bottom). Similarly, KLF11 was found to be constitutively expressed in the nucleus of pancreatic cancer cells, independent from the presence or absence of ERK–mitogen-activated protein kinase (MAPK) signaling (data not shown). Together, these findings strongly suggested that ERK inhibits TGFß-induced c-myc down-regulation in pancreatic cancer cells through mechanisms different from those described in EpRas cells.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 7. Inhibition of ERK-MAPK restores TGFß-induced c-myc repression in pancreatic cancer cells. A. Panc-1 cells were transiently transfected with TIE-wt and treated with either TGFß (5 ng/mL), U0126 (0.5 µmol/L), or a combination of both agents. Firefly luciferase activity was measured, normalized to Renilla luciferase controls and expressed as relative luciferase activity (RLA). B. Pharmacologic inhibition of endogenous ERK restores the ability of TGFß to repress endogenous c-myc mRNA expression. Panc-1 cells were pretreated with medium in the absence or presence of U0126 (0.5 µmol/L) before the application of TGFß for an additional 3 hours. Endogenous c-myc mRNA expression levels were determined by Northern blot analysis. The 28S-rRNA ethidium bromide band was included to control for loading. C. Fluorescence microscopy demonstrating that ERK-MAPK does not affect the ability of Smad3 to translocate into the nucleus upon TGFß treatment. Top, TGFß successfully induces cytoplasmic-nuclear shuttling of Smad3 in Panc-1 cells. Bottom, TGFß-induced translocation of Smad3 remains unaffected by pretreatment with the ERK inhibitor, U0126. Localization of Smad3 was detected by anti-Smad2/3 antibodies. Nuclei were visualized by 4',6-diamidino-2-phenylindole staining.

 
ERK-MAPK Inhibits Smad3-KLF11 Interaction and TIE-Binding in Pancreatic Cancer Cells
In order to assess whether ERK modulates TGFß-signaling on the level of Smad3-KLF11 complex formation, we did coimmunoprecipitation studies with Panc-1 cells treated with either TGFß, U0126, or a combination of both. Figure 8A shows that in the absence of the inhibitor, only trace amounts of Smad3 were precipitated in complex with KLF11 after TGFß treatment. Inhibition of ERK signaling, however, dramatically increased the amount of Smad3 coprecipitating with KLF11 in response to TGFß stimulation. Moreover, DNA pulldown assays revealed that whereas in the absence of ERK inhibitor, only minute amounts of KLF11 and Smad3 bound to the TIE in response to TGFß treatment, pretreatment of the cells with U0126 significantly enhanced TGFß-induced binding of both factors to the TIE element (Fig. 8B). Of note, U0126 treatment had no effect on either KLF11 expression or Smad3 phosphorylation.


Figure 8
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. ERK-MAPK disrupts Smad3-KLF11 interaction and TIE-binding in pancreatic cancer cells. A. Panc-1 cells were transfected with FLAG-KLF11 and treated with either TGFß (5 ng/mL), U0126 (0.5 µmol/L), or a combination of both agents before isolation of nuclear proteins. Nuclear KLF11 was immunoprecipitated by agarose-bound anti-FLAG antibodies and KLF11-interacting Smad3 was detected using Smad3 antibodies. Inhibition of ERK significantly increases Smad3-KLF11 complex formation in pancreatic cancer cells upon TGFß treatment. B. Biotinylated c-myc TIE-wt oligonucleotides were incubated with nuclear proteins from KLF11-transfected Panc-1 cells, which were treated with TGFß or U0126 as indicated. TIE-bound proteins were detected by immunoblotting using anti-FLAG and anti-Smad3 antibodies, respectively. Western blots were also done to control for endogenous ERK activity (anti-pERK) and the phosphorylation status of Smad3 (anti-pSmad3). ERK inhibition significantly increases the amount of Smad3 and KLF11 bound to the TIE element upon TGFß treatment. C. ERK inhibition restores TGFß-induced growth inhibition in pancreatic cancer cells. Panc-1 cells were treated with TGFß (5 ng/mL) in the presence or absence of U0126 (0.5 µmol/L) for 24 hours. Proliferation was measured by thymidine incorporation.

 
Finally, we investigated whether reconstitution of Smad3-KLF11 interaction and TIE promoter binding restores the capacity of TGFß to inhibit proliferation in pancreatic cancer cells with an oncogenic K-Ras mutation. Proliferation assays were carried out upon application of TGFß, and in the presence or absence of the ERK inhibitor. As noted previously (see Fig. 6A), application of TGFß alone did not exert significant effects on cell proliferation in Panc-1 cells with hypersensitive ERK. In contrast, however, inactivation of endogenous ERK by pretreatment of the cells with U0126 resulted in a moderate inhibition of basal cell proliferation and completely restored TGFß-induced growth inhibition in pancreatic cancer cells (Fig. 8C).


    Discussion
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Based on previous findings demonstrating that the zinc finger transcription factor KLF11 is highly induced by TGFß and, when overexpressed, mimics a TGFß-induced cell cycle arrest in epithelial cells, it has long been suspected that KLF11 might be a downstream effector of TGFß in cell growth control (12, 15). Additional support for this hypothesis was gathered by more recent investigations, which proposed a link between KLF11-regulated gene expression and the capacity of TGFß to suppress cell proliferation (13, 15, 16). We and others have shown, for instance, that KLF11-induced growth inhibition requires the ability to repress gene expression, and that KLF11, via down-regulation of the inhibitory Smad7 protein, increases TGFß-induced gene transcription in TGFß-sensitive epithelial cells, but not in pancreatic cancer cells (13, 17, 18). However, neither of the previous studies provided evidence for a direct role of KLF11 in TGFß-mediated control of growth-regulating genes, nor have the underlying molecular mechanisms in KLF11-induced growth inhibition been studied in detail.

In the present study, the role of KLF11 in TGFß-induced growth inhibition was analyzed in established TGFß-responsive cell systems, in which TGFß treatment rapidly blocks c-myc expression and subsequently induces a cytostatic gene program that arrests cells in the late G1 phase (22, 33). It has previously been shown that TGFß silences c-myc primarily on the transcriptional level through rapid and efficient repression of the TIE, which is located in close proximity to the P2 transcription start site of the c-myc promoter (22). Mutational inactivation of the TIE element prevents c-myc repression by TGFß and as a consequence of impaired c-myc repression, epithelial cells render refractory to TGFß-antiproliferation (22). We now show that endogenous KLF11 expression is required for full c-myc promoter inhibition by TGFß, and most importantly, identified KLF11 as a downstream TGFß effector protein which binds to a specific promoter sequence within the TIE core region to repress transcription in response to TGFß stimulation. Moreover, we were also able to show that KLF11 cooperates with activated Smad3 in c-myc TIE repression. Mechanistically, nuclear KLF11 forms a complex with Smad3 and increases its binding to the TIE element upon TGFß stimulation. The relevance of this novel protein-protein interaction was fundamentally substantiated by the observation that mutational disruption of KLF11-Smad3 interaction or small interfering RNA–mediated knockdown of KLF11 expression strongly diminished Smad3-TIE c-myc promoter binding, caused loss of c-myc repression, and rendered epithelial cells less sensitive to TGFß-induced growth inhibition. Together, these data clearly show that KLF11 and Smad3 transcription factors synergize in TGFß-induced cell growth inhibition through cooperative repression of the c-myc oncogene.

An alternative mechanism in TGFß-induced c-myc repression has recently been reported by Chen and coworkers, which is defined by interaction of Smad3 with p107 and members of the E2F transcription factor family (26). Like KLF11, E2F4 and E2F5 act primarily as transcriptional repressors that accumulate when cells undergo G1 arrest. In contrast to nuclear KLF11-Smad3 interaction, however, E2F4 and E2F5 associate with p107 and assemble a cytoplasmic complex with Smad3 that subsequently translocates into the nucleus following TGFß receptor activation. These observations, together with our own results, suggest that at least two distinct mechanisms involving interaction with transcriptional repressor proteins exist in Smad3-mediated c-myc repression. It is not clear at this point, however, whether the two different mechanisms work in a cell type–dependent or independent manner and whether E2F and KLF11 compete for Smad3 interaction in this important TGFß function.

The central role of KLF11 in TGFß-induced epithelial cell growth inhibition also has important implications in carcinogenesis. Similar to its effects on normal epithelial cells, TGFß inhibits the growth of early stage epithelial tumors (34). As the tumor progresses, however, epithelial cancer cells frequently lose the capacity to undergo growth inhibition in response to TGFß signaling (35). It is abundantly clear that loss-of-function mutations of TGFß signaling components is one route towards loss of growth control in cancer (35, 36). On the other hand, however, many cancer cells escape c-myc repression and thus become refractory to the growth-inhibitory effects of TGFß despite the lack of genetic alterations in the TGFß signaling pathway (37). In these cases, cross-talk with the proliferative Ras-Raf-ERK-MAPK pathway might significantly alter the activation status or the nuclear constellation of the Smad proteins as well as their partner transcription factors, thus influencing the transcriptional response to TGFß in cancer cells (22, 36, 37). Consistent with this model, we now show impaired TGFß-induced c-myc repression and growth inhibition in a set of pancreatic cancer cells with hyperactivated ERK, resulting from mutational activation of the K-Ras oncogene. Several modes of action of activated ERK in antagonizing Smad-mediated transcription have previously been identified, including interference with receptor activation–induced nuclear translocation of Smad3 (32, 38-40). We have tested whether this principle also applies in pancreatic cancer cells, but to our surprise, receptor-induced cellular distribution of Smad3 remained affected by modulation of ERK activity. On the other hand, we observed a dramatic reduction of KLF11-Smad3 protein interaction in pancreatic cancer cells as compared with normal epithelial cells, and presumably as a consequence of this, diminished binding of both factors to the TIE element. Impaired DNA binding was not due to reduced expression of the transcription factors, as was shown in this and earlier studies and TGFß-mediated cooperative repression of the c-myc TIE was fully restored upon inhibition of endogenous ERK activity (17, 18). Biochemical analyses from our group have recently shown that the NH2-terminal transcriptional repression domain of KLF11 becomes highly phosphorylated by activated ERK and that this modification antagonizes binding to the mSin3A corepressor in pancreatic cancer cells (41). However, it seems unlikely that this is also the mechanism by which ERK interferes with the ability of KLF11 to interact with Smad3 because we have shown that it is the COOH-terminal domain, rather than the NH2-terminal domain, of KLF11 which is responsible for the interaction with Smad3. Further studies are thus warranted to elucidate the precise molecular mechanisms by which ERK disrupts KLF11-Smad3 binding.

In summary, we conclude that KLF11 is an essential partner of Smad3 in the transcriptional silencing of the growth-stimulatory c-myc proto-oncogene in normal epithelial cells, which in turn, is a key step in TGFß-induced cell growth inhibition. Aberrant activation of ERK-MAPK interferes with KLF11-Smad3 complex formation, preventing the binding of both transcription factors to the TIE promoter element, and thus resulting in impaired c-myc repression and loss of growth inhibition by TGFß in pancreatic cancer cells.


    Materials and Methods
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Cell Culture, Transfection, and Reporter Assays
HEK-293, EpH4, Panc-1, IMIM PC-2, Suit-007, and Suit-028 cells were maintained in DMEM supplemented with 10% FCS and 100 units/mL of penicillin/streptomycin (Invitrogen Life Technologies, Eggenstein, Germany). The medium for the stably transfected HEK-293 cells was additionally supplemented with 25 µg/mL of G418 (Invitrogen Life Technologies). MCF-10A cells were maintained in a 1:1 mixture of DMEM and Ham's F-12 (Invitrogen Life Technologies) supplemented with 5% horse serum (Invitrogen Life Technologies), 10 µg/mL of insulin (Sigma-Aldrich Corporation, St. Louis, MO), 5 µg/mL of hydrocortisone (Calbiochem, La Jolla, CA), and 0.02 µg/mL of epidermal growth factor (Calbiochem, Bad Soden, Germany) and 0.01 µg/mL of cholera toxin (Sigma-Aldrich). HEK-293 and IMIM PC-2 cells were transfected using jetPEI (Qbiogene, Heidelberg, Germany), Panc-1, Suit-028, and Suit-007 cells were transfected with TransFast (Promega, Madison, WI). For reporter assays, cells were cultured in 24-well tissue plates. Twenty-four hours after transfection, luciferase assays were done using a CENTRO LB 960 luminometer (Berthold Technologies, Bad Wildbad, Germany) and the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's suggestions. All reporter studies were done in triplicate in at least three independent experiments. Firefly luciferase values were normalized to Renilla luciferase activity and were expressed as relative luciferase activity.

Plasmid Constructs and Generation of Stable Cell Lines
His-tagged KLF11 plasmids, FLAG-KLF11, GST-KLF11-NTD, and GST-KLF11-CTD were obtained from R. Urrutia (Mayo Clinic, Rochester, MN). The expression plasmids encoding constitutively activated TGFß type I receptor and FLAG-Smad3 were obtained from R. Derynck (University of California, San Francisco, CA). The luciferase reporter plasmids Myc-wt, TIE-wt, and TIE-Mcore were obtained from J. Massague (Memorial Sloan-Kettering Cancer Center, New York, NY). The Myc-Mcore reporter plasmid was generated from the Myc-wt (–2446 to +334) reporter construct by using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Mutagenesis primers were 5'-CTCGAGAAGGGCAGGGCTTCTCAGATTAAACTTTGGAAAAAGAACGGAGGGAGG GATCG-3' and its complementary strand. To generate the reporter plasmids, TIE-SBEmut, TIE-KBEmut, and TIE-SBE/KBEmut, the following double-stranded oligonucleotides were cloned into pGL3 Enhancer (Promega): TIE-SBEmut, 5'-TTCTCAGATTGAAGGCGGGAAAAAGAACGG-3' and its complementary strand; c-myc TIE-KBEmut, 5'-TTCTCAGAGGCTTCTTTGGAAAAAGAACGG-3' and its complementary strand; and c-myc TIE-SBE/KBEmut, 5'-TTCTCAGATTGAACTTTGGAAAAAGAACGG-3' and its complementary strand.

To knock down the expression of endogenous KLF11 in HEK-293 cells, we generated the pSilencerKLF11 construct by cloning the oligonucleotide 5'-GATCCCAGGTCTACTTGCAGCATCTTTCAAGAGAAGATGCTGCAAGTAGACCTTTTTTTGGAAA-3' and its complementary strand into the pSilencer H3.1-H1 hygro vector (Ambion, Cambridgeshire, United Kingdom). The oligonucleotide was chosen so that homology to nontargeted genes was <15 nucleotides, as determined by BLAST analysis. As a negative control, we used the pSilencer H3.1-H1 hygro control vector (Ambion), which encodes for an unspecific small interfering RNA (pSilencerns). pSilencerKLF11 and pSilencerns were transfected into HEK-293 cells, stable cell lines were selected with G418 (25 µg/mL) and individual clones were isolated.

Whole Cell Lysate, Nuclear Extracts, Immunoprecipitation, and Western Blot Analysis
Cells were transfected with expression plasmids as indicated. Twenty-four hours after transfection, cells were either left untreated, incubated with 5 ng/mL of TGFß1 (PromoCell, Heidelberg, Germany) for 1 hour, pretreated with 0.5 µmol/L of U0126 (Biomol, Plymouth Meeting, PA) for 2 hours, or treated with both agents. For whole cell lysates, cells were lysed in buffer [50 mmol/L HEPES (pH 7.5), 150 mmol/L NaCl, 1 mmol/L EGTA, 10% glycerol, 1% Triton X-100, 100 mmol/L NaF, and 10 mmol/L Na4P2O7]. For nuclear extracts, cells were lysed in buffer [10 mmol/L HEPES (pH 7.9), 10 mmol/L KCl, 0.1 mmol/L EGTA, 0.1 mmol/L EDTA, 0.5 mmol/L PMFS, and 1 mmol/L DTT] and incubated on ice for 15 minutes. Following homogenization, nuclei were dissolved in buffer [20 mmol/L HEPES (pH 7.9), 400 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L PMFS, and 1 mmol/L DTT]. The proteins were incubated for 60 minutes on a shaker and centrifuged at 14,000 rpm for 20 minutes. For immunoprecipitation, 100 µg of nuclear proteins or 500 µg of whole cell lysate were subjected to immunoprecipitation using anti-Smad2/3 (Upstate Biotechnology, Lake Placid, NY) or anti-FLAG M2 antibodies (Sigma-Aldrich). The resulting complexes were collected by centrifugation at 500 x g for 5 minutes and washed with buffer [200 mmol/L HEPES (pH 7.5), 600 mmol/L NaCl, 40% glycerol, and 0.4% Triton X-100]. Western blot analyses were done using the following primary antibodies: anti-FLAG M2 (Sigma-Aldrich), anti-Smad2/3 (Upstate Biotechnology), anti-phospho-ERK1/2 (p42/44; New England Biolabs, Ipswich, MA), anti-phospho-Smad3 (New England Biolabs), and anti-GST (Amersham Biosciences, Uppsala, Sweden).

GST Proteins and GST Pulldown Assays
The expression of GST-KLF11, GST-KLF11-NTD, and GST-KLF11-CTD fusion proteins was induced in BL21 cell (Stratagene) by the addition of 2 mmol/L of isopropyl-ß-D-thiogalacopyranoside (Sigma-Aldrich) and incubation for 2 hours at 32°C. Cells were lysed by the addition of lysozyme (Sigma-Aldrich) and fusion proteins were subsequently purified using glutathione Sepharose 4B affinity chromatography in accordance with the manufacturer's (Amersham Biosciences, Uppsala, Sweden) suggestions. For GST pulldown and electrophoretic mobility shift assays, the [35S]methionine-labeled FLAG-tagged Smad3 was produced by in vitro translation using the TnT coupled transcription-translation system under the conditions recommended by the manufacturer (Promega). The in vitro–translated Smad3 was precleared by incubation with GST and glutathione Sepharose beads for 30 minutes at 4°C, followed by centrifugation at 500 x g for 5 minutes. The supernatant was transferred to fresh tubes and incubated with GST, GST-KLF11-NTD, or GST-KLF11-CTD and additional glutathione Sepharose beads for 2 hours at 4°C. Complexes were pelleted by centrifugation at 500 x g for 5 minutes, washed twice with buffer A [40 mmol/L HEPES (pH 7.5), 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5% Nonidet-P40, and 300 mmol/L KCl], twice with buffer B [40 mmol/L HEPES (pH 7.5), 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5% Nonidet-P40, and 500 mmol/L KCl], and twice with buffer C [40 mmol/L HEPES (pH 7.5), 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5% Nonidet-P40, and 700 mmol/L KCl] and separated by SDS-PAGE. Smad3 was detected by autoradiography and the GST fusion proteins were detected by immunoblotting using anti-GST antibody (Amersham Biosciences, Uppsala, Sweden).

DNA Pulldown Assay
Cells were transfected with expression plasmids as indicated. Twenty-four hours after transfection, cells were either treated with 5 ng/mL of TGFß1 for 1 hour, pretreated with 0.5 µmol/L of U0126, or incubated in medium containing both agents. Five hundred micrograms of whole cell lysate or 100 µg of nuclear proteins per sample were incubated with 1 µg of biotinylated double-stranded oligonucleotides corresponding to the wild-type (TIE-wt) or mutant c-myc TIE sequences (TIE-Mcore, TIE-SBEmut, TIE-KBEmut, or TIE-SBE/KBEmut). After 3 hours of incubation time, DNA-protein complexes were collected by precipitation with streptavidin-agarose beads (Sigma-Aldrich) for 1 hour, washed twice with buffer, and subjected to Western blot analysis. The sequences of wild-type and mutant TIE oligonucleotides are illustrated in Figs. 3A and 4D. To study simultaneous Smad3/KLF11 binding to the TIE, Flag-tagged immunoprecipitates were eluted with Flag-tagged peptide, resuspended, and subjected to DNA pulldown assays.

Gel Shift Assays
For gel shift assays (electrophoretic mobility shift assay), the double-stranded oligonucleotides corresponding to the wild-type (TIE-wt) or mutant c-myc TIE core sequence (TIE-Mcore) was end-labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase according to manufacturer's suggestions (Promega). Two hundred nanograms of purified GST or GST-KLF11 fusion protein were incubated for 10 minutes at room temperature in a buffer containing [20 mmol/L HEPES (pH 7.5), 50 mmol/L KCL, 5 mmol/L MgCl2, 10 µmol/L ZnCl2, 6% glycerol, 200 µg/mL bovine serum albumin, and 50 µg/mL poly(dI-dC)poly(dI-dC)]. An end-labeled probe (0.035 pmol) was then added to each reaction for an additional 20 minutes and subsequently loaded onto a 4% nondenaturing polyacrylamide gel. Samples were run for 3 to 4 hours at 160 V at room temperature, vacuum dried, and exposed to BIOMAX MR Film (Eastman Kodak Co., New Haven, CT).

Immunofluorescence
Cells were grown on chambered coverslips and either treated with 5 ng/mL of TGFß1 (PromoCell) for 1 hour, pretreated with 0.5 µmol/L of U0126 (Biomol) for 2 hours, or a combination of both agents. Cells were then washed, fixed, blocked, and probed with anti-Smad2/3 antibodies (1:100; Upstate, Charlottesville, VA). Visualization was realized using a fluorochrome-conjugated secondary antibody and nuclei were counterstained with 4',6-diamidino-2-phenylindole. Coverslips were mounted on glass slides and cells were observed with a fluorescence microscope (Carl Zeiss, Inc., Oberkochern, Germany).

Northern Blot Analysis
RNA was extracted using the RNeasy Midi Kit (Qiagen GmbH, Hilden, Germany). For Northern blot analysis, 20 µg of total RNA were size-fractionated and transferred to Hybond N membranes (Amersham Biosciences, Buckinghamshire, England). Northern blots were hybridized with [32P]-labeled cDNA probes for c-Myc or KLF11, which were generated by random prime-labeling with the Megaprime DNA labeling system (Amersham Biosciences, Buckinghamshire, England). The probes for c-Myc and KLF11 comprised their complete coding sequences, respectively.

[3H]Thymidine Proliferation Assay
[3H]Thymidine proliferation assays were done as described previously (42). In brief, cells were seeded to a 96-well tissue culture plate at 1,000 cells/well in DMEM and incubated at 37°C. [3H]Thymidine was added to a concentration of 0.5 µCi/well, and the plates were incubated for an additional 4 to 5 hours. Pharmacologic agents were added as indicated. All studies were done in triplicate in at least two independent experiments.


    Acknowledgements
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
We gratefully acknowledge Jessica Motzer for excellent technical assistance, and Raul Urrutia, Rick Derynck, and Joan Massague for the expression constructs.


    Notes
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Grant support: Deutsche Krebshilfe (Max-Eder program 70-3022-EI 1) to V.Ellenrieder.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 3/24/06; revised 8/29/06; accepted 8/31/06.


    References
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Massague J, Chen YG. Controlling TGF-ß signaling. Genes Dev 2000;14:627–44.[Free Full Text]
  2. Zavadil J, Bitzer M, Liang D, et al. Genetic programs of epithelial cell plasticity directed by transforming growth factor-ß. Proc Natl Acad Sci U S A 2001;98:6686–91.[Abstract/Free Full Text]
  3. Seoane J, Pouponnot C, Staller P, Schader M, Eilers M, Massague J. TGFß influences Myc, Miz-1 and Smad to control the CDK inhibitor p15INK4b. Nat Cell Biol 2001;3:400–8.[CrossRef][Medline]
  4. Massague J, Blain SW, Lo RS. TGFß signaling in growth control, cancer, and heritable disorders. Cell 2000;103:295–309.[CrossRef][Medline]
  5. Staller P, Peukert K, Kiermaier A, et al. Repression of p15INK4b expression by Myc through association with Miz-1. Nat Cell Biol 2001;3:392–9.[CrossRef][Medline]
  6. Warner BJ, Blain SW, Seoane J, Massague J. Myc downregulation by transforming growth factor ß required for activation of the p15(Ink4b) G(1) arrest pathway. Mol Cell Biol 1999;19:5913–22.[Abstract/Free Full Text]
  7. Shi Y, Massague J. Mechanisms of TGF-ß signaling from cell membrane to the nucleus. Cell 2003;113:685–700.[CrossRef][Medline]
  8. Heldin CH, Miyazono K, ten Dijke P. TGF-ß signalling from cell membrane to nucleus through SMAD proteins. Nature 1997;390:465–71.[CrossRef][Medline]
  9. Massague J, Wotton D. Transcriptional control by the TGF-ß/Smad signaling system. EMBO J 2000;19:1745–54.[CrossRef][Medline]
  10. Massague J. How cells read TGF-ß signals. Nat Rev Mol Cell Biol 2000;1:169–78.[CrossRef][Medline]
  11. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-ß family signalling. Nature 2003;425:577–84.[CrossRef][Medline]
  12. Tachibana I, Imoto M, Adjei PN, et al. Overexpression of the TGFß-regulated zinc finger encoding gene, TIEG, induces apoptosis in pancreatic epithelial cells. J Clin Invest 1997;99:2365–74.[Medline]
  13. Cook T, Gebelein B, Mesa K, Mladek A, Urrutia R. Molecular cloning and characterization of TIEG2 reveals a new subfamily of transforming growth factor-ß-inducible Sp1-like zinc finger-encoding genes involved in the regulation of cell growth. J Biol Chem 1998;273:25929–36.[Abstract/Free Full Text]
  14. Johnsen SA, Subramaniam M, Janknecht R, Spelsberg TC. TGFß inducible early gene enhances TGFß/Smad-dependent transcriptional responses. Oncogene 2002;21:5783–90.[CrossRef][Medline]
  15. Cook T, Urrutia R. TIEG proteins join the Smads as TGF-ß-regulated transcription factors that control pancreatic cell growth. Am J Physiol Gastrointest Liver Physiol 2000;278:G513–21.[Abstract/Free Full Text]
  16. Cook T, Gebelein B, Urrutia R. Sp1 and its likes: biochemical and functional predictions for a growing family of zinc finger transcription factors. Ann N Y Acad Sci 1999;880:94–102.[CrossRef][Medline]
  17. Fernandez-Zapico ME, Mladek A, Ellenrieder V, Folch-Puy E, Miller L, Urrutia R. An mSin3A interaction domain links the transcriptional activity of KLF11 with its role in growth regulation. EMBO J 2003;22:4748–58.[CrossRef][Medline]
  18. Ellenrieder V, Buck A, Harth A, et al. KLF11 mediates a critical mechanism in TGF-ß signaling that is inactivated by ERK-MAPK in pancreatic cancer cells. Gastroenterology 2004;127:607–20.[CrossRef][Medline]
  19. Soule HD, Maloney TM, Wolman SR, et al. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res 1990;50:6075–86.[Abstract/Free Full Text]
  20. Petritsch C, Beug H, Balmain A, Oft M. TGF-ß inhibits p70 S6 kinase via protein phosphatase 2A to induce G(1) arrest. Genes Dev 2000;14:3093–101.[Abstract/Free Full Text]
  21. Kerr LD, Miller DB, Matrisian LM. TGF-ß1 inhibition of transin/stromelysin gene expression is mediated through a Fos binding sequence. Cell 1990;61:267–78.[CrossRef][Medline]
  22. Chen CR, Kang Y, Massague J. Defective repression of c-myc in breast cancer cells: a loss at the core of the transforming growth factor ß growth arrest program. Proc Natl Acad Sci U S A 2001;98:992–9.[Abstract/Free Full Text]
  23. Yagi K, Furuhashi M, Aoki H, et al. c-myc is a downstream target of the Smad pathway. J Biol Chem 2002;277:854–61.[Abstract/Free Full Text]
  24. Hata A, Seoane J, Lagna G, Montalvo E, Hemmati-Brivanlou A, Massague J. OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 2000;100:229–40.[CrossRef][Medline]
  25. Frederick JP, Liberati NT, Waddell DS, Shi Y, Wang XF. Transforming growth factor ß-mediated transcriptional repression of c-myc is dependent on direct binding of Smad3 to a novel repressive Smad binding element. Mol Cell Biol 2004;24:2546–59.[Abstract/Free Full Text]
  26. Chen CR, Kang Y, Siegel PM, Massague J. E2F4/5 and p107 as Smad cofactors linking the TGFß receptor to c-myc repression. Cell 2002;110:19–32.[CrossRef][Medline]
  27. Wenger C, Ellenrieder V, Alber B, et al. Expression and differential regulation of connective tissue growth factor in pancreatic cancer cells. Oncogene 1999;18:1073–80.[CrossRef][Medline]
  28. Javelaud D, Mauviel A. Crosstalk mechanisms between the mitogen-activated protein kinase pathways and Smad signaling downstream of TGF-ß: implications for carcinogenesis. Oncogene 2005;24:5742–50.[CrossRef][Medline]
  29. Schneider G, Schmid RM. Genetic alterations in pancreatic carcinoma. Mol Cancer 2003;2:15.[CrossRef][Medline]
  30. Moore PS, Beghelli S, Zamboni G, Scarpa A. Genetic abnormalities in pancreatic cancer. Mol Cancer 2003;2:7.[Medline]
  31. Moore PS, Sipos B, Orlandini S, et al. Genetic profile of 22 pancreatic carcinoma cell lines. Analysis of K-ras, p53, p16 and DPC4/Smad4. Virchows Arch 2001;439:798–802.[Medline]
  32. Kretzschmar M, Doody J, Timokhina I, Massague J. A mechanism of repression of TGFß/Smad signaling by oncogenic Ras. Genes Dev 1999;13:804–16.[Abstract/Free Full Text]
  33. Oft M, Peli J, Rudaz C, Schwarz H, Beug H, Reichmann E. TGF-ß1 and Ha-Ras collaborate in modulating the phenotypic plasticity and invasiveness of epithelial tumor cells. Genes Dev 1996;10:2462–77.[Abstract/Free Full Text]
  34. Siegel PM, Massague J. Cytostatic and apoptotic actions of TGF-ß in homeostasis and cancer. Nat Rev Cancer 2003;3:807–21.[CrossRef][Medline]
  35. de Caestecker MP, Piek E, Roberts AB. Role of transforming growth factor-ß signaling in cancer. J Natl Cancer Inst 2000;92:1388–402.[Abstract/Free Full Text]
  36. Piek E, Roberts AB. Suppressor and oncogenic roles of transforming growth factor-ß and its signaling pathways in tumorigenesis. Adv Cancer Res 2001;83:1–54.[Medline]
  37. Derynck R, Akhurst RJ, Balmain A. TGF-ß signaling in tumor suppression and cancer progression. Nat Genet 2001;29:117–29.[CrossRef][Medline]
  38. Lo RS, Wotton D, Massague J. Epidermal growth factor signaling via Ras controls the Smad transcriptional co-repressor TGIF. EMBO J 2001;20:128–36.[CrossRef][Medline]
  39. Roelen BA, Cohen OS, Raychowdhury MK, et al. Phosphorylation of threonine 276 in Smad4 is involved in transforming growth factor-ß-induced nuclear accumulation. Am J Physiol Cell Physiol 2003;285:C823–30.[Abstract/Free Full Text]
  40. Matsuura I, Wang G, He D, Liu F. Identification and characterization of ERK MAP kinase phosphorylation sites in Smad3. Biochemistry 2005;44:12546–53.[CrossRef][Medline]
  41. Ellenrieder V, Zhang JS, Kaczynski J, Urrutia R. Signaling disrupts mSin3A binding to the Mad1-like Sin3-interacting domain of TIEG2, an Sp1-like repressor. EMBO J 2002;21:2451–60.[CrossRef][Medline]
  42. Giehl K, Skripczynski B, Mansard A, Menke A, Gierschik P. Growth factor-dependent activation of the Ras-Raf-MEK-MAPK pathway in the human pancreatic carcinoma cell line PANC-1 carrying activated K-ras: implications for cell proliferation and cell migration. Oncogene 2000;19:2930–42.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
L. Ma, R. L. Hanson, L. N. Que, J. L. Mack, P. W. Franks, A. M. Infante, S. Kobes, C. Bogardus, and L. J. Baier
Association Analysis of Kruppel-Like Factor 11 Variants with Type 2 Diabetes in Pima Indians
J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3644 - 3649.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. A. Mallette, M.-F. Gaumont-Leclerc, G. Huot, and G. Ferbeyre
Myc Down-regulation as a Mechanism to Activate the Rb Pathway in STAT5A-induced Senescence
J. Biol. Chem., November 30, 2007; 282(48): 34938 - 34944.
[Abstract] [Full Text] [PDF]