Molecular Cancer Research Holland CR Podcast
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, P.-Y.
Right arrow Articles by Miyamoto, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, P.-Y.
Right arrow Articles by Miyamoto, S.
Molecular Cancer Research 4:101-112 (2006)
© 2006 American Association for Cancer Research

Cell Cycle, Cell Death, and Senescence

Nuclear Factor-{kappa}B Dimer Exchange Promotes a p21waf1/cip1 Superinduction Response in Human T Leukemic Cells

Pei-Yun Chang and Shigeki Miyamoto

Program in Molecular and Cellular Pharmacology, Department of Pharmacology, University of Wisconsin-Madison, Madison, Wisconsin

Requests for reprints: Shigeki Miyamoto, Program in Molecular and Cellular Pharmacology, Department of Pharmacology, University of Wisconsin-Madison, 301 Medical Sciences Center, 1300 University Avenue, Madison, WI 53706. Phone: 608-262-9281; Fax: 608-262-1257. E-mail: smiyamot{at}wisc.edu


   Abstract
Top
 Notes
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
The nuclear factor-{kappa}B (NF-{kappa}B)/Rel transcription factors are recognized as critical apoptosis regulators. We reported previously that NF-{kappa}B contributes to chemoresistance of CEM human T leukemic cells in part through its ability to induce p21waf1/cip1. Here, we provide evidence that sequential NF-{kappa}B-activating signals induce heightened NF-{kappa}B DNA binding and p21waf1/cip1 induction in CEM and additional T leukemic cell lines. This response arises from exceedingly low basal expression of the p105/p50 NF-{kappa}B subunit encoded by the NFKB1 gene in these cell lines. An initial NF-{kappa}B activation event enhances the recruitment of p65 and ELF1 to the NFKB1 promoter, leading to p65- and ELF1-dependent synthesis of p105/p50, which promotes an exchange of NF-{kappa}B complexes to p50-containing complexes with an increased DNA-binding activity to certain NF-{kappa}B target elements. Subsequent stimulation of these cells with an anticancer agent, etoposide, results in augmented NF-{kappa}B-dependent p21waf1/cip1 induction and increased chemoresistance of the leukemia cells. Thus, we propose that low basal NFKB1 expression coupled with sequential NF-{kappa}B activation events can promote increased chemoresistance in certain T leukemic cells. (Mol Cancer Res 2006;4(2):101–12)


   Introduction
Top
 Notes
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
The nuclear factor-{kappa}B (NF-{kappa}B)/Rel family of transcription factors regulates a wide range of cellular functions, including immune/inflammatory responses, proliferation, and apoptosis (1). In particular, recent studies identified NF-{kappa}B as a critical mediator that regulates transcription of survival genes implicated in resistance of cancer cells to chemotherapy and radiation therapy (reviewed in ref. 2). These NF-{kappa}B-induced survival genes include the antiapoptotic Bcl-2 family members and the cellular inhibitors of apoptosis family of caspase inhibitors (3-7). In addition, a NF-{kappa}B-dependent induction of p21cip1/waf1, a cyclin-dependent kinase inhibitor that is normally under the control of the tumor suppressor p53 (8-10), also contributes to chemoresistance in certain p53-defective cancer cell types (11). Moreover, deregulation of NF-{kappa}B-regulatory pathways is a frequent occurrence in a variety of human cancer types (reviewed in ref. 12). Thus, pharmacologic inhibition of NF-{kappa}B pathways is considered to be a plausible anticancer strategy (reviewed in refs. 12, 13).

The NF-{kappa}B/Rel family consists of p50, p65, RelB, cRel, and p52 in mammals (reviewed in ref. 14). These five NF-{kappa}B proteins generate most combinations of homodimers or heterodimers to mediate NF-{kappa}B-dependent transcriptional regulation. The prototypical p50:p65 heterodimer is held inactive in the cytoplasm of most cell types due to association with the inhibitory proteins, such as I{kappa}B{alpha} (reviewed in ref. 14). Activation of NF-{kappa}B involves post-translational mechanisms involving the activation of the I{kappa}B kinase (IKK) complex and subsequent IKK-dependent phosphorylation and ubiquitin/proteasome-mediated degradation of I{kappa}B{alpha} to liberate free NF-{kappa}B that then translocates into the nucleus and activates transcription of target genes (reviewed in refs. 14, 15).

In addition to these post-translational mechanisms, the NF-{kappa}B/Rel dimer activation potential is also regulated at the transcriptional level. This regulation involves both basal and signal-inducible changes in the levels of each of the family members. For example, early studies suggested that p50 (encoded by the NFKB1 gene) and p65 (encoded by the RELA gene) are ubiquitously expressed in most tissue types (16-18). The basal expression of other family members seems to greatly vary depending on specific cellular contexts (19, 20). Additionally, NF-{kappa}B can autoregulate the expression of most of its family members, except for p65 (21-26). In particular, the signal-dependent induction of NFKB1 gene that encodes p105, the precursor of p50, was the first to be described as NF-{kappa}B dependent (25, 26). Although the involvement of the ETS family of proteins is implicated in this induction, the specific family member involved has not been revealed (27). Nevertheless, transcriptional autoregulation of NF-{kappa}B family members can modulate the cellular content of different NF-{kappa}B dimers, leading to differential activation potentials for different dimeric complexes. This type of regulation has been implicated in certain developmental processes, including B and dendritic cell development, where major NF-{kappa}B dimers seem to alter as the cell proceeds through maturation processes (28-30).

In T lymphocytes and T leukemic cell lines, differential activation of NF-{kappa}B dimers has also been described to impart important regulation on target gene transcription and cell functions. Studies have shown that T-cell receptor engagement of Th1 T-helper cells leads to rapid activation of a p50:p65 heterodimer, whereas similar stimulation of Th2 cells leads to delayed activation of p65 complexes devoid of the p50 subunit, thereby possibly contributing to differential cytokine gene regulation (31). A more recent study has shown that differential induction of cRel-containing NF-{kappa}B complexes regulates cytokine-mediated priming of naive T cells to overcome their intrinsic refractoriness for cytokine production in response to T-cell receptor engagement (32). Similarly, distinct NF-{kappa}B dimers have been shown to respond to different stimuli in various T leukemic cells (e.g., Jurkat, CEM, ACH-2, and MET-1), thereby contributing to differential target gene regulation (31-39). For example, CEM cells have been described to activate multiple ill-defined NF-{kappa}B complexes following stimulation with DNA-damaging agents, such as camptothecin, etoposide (VP16), and ionizing radiation (33, 40). Although NF-{kappa}B-dependent induction of p21cip1/waf1 was found to promote chemoresistance of these cells (11), the contribution of different NF-{kappa}B dimers to such resistance gene induction remains to be determined.

In the present study, we were originally testing the hypothesis that activation of protein kinase C (PKC) is critical for NF-{kappa}B activation by genotoxic agents in CEM T leukemic cells. This hypothesis was based on previous observations that PKC activation can lead to NF-{kappa}B activation and PKC can be activated by different genotoxic agents (41-44). However, we did not find evidence for a critical role for PKC in this signaling pathway. Instead, we found an unexpected and highly enhanced NF-{kappa}B activation when CEM cells are first exposed to 12-O-tetradecanoylphorbol-13-acetate (TPA) and then to VP16. This enhanced NF-{kappa}B response resulted in superinduction (~1,800-fold over basal) of p21cip1/waf1 RNA and heightened chemoresistance in CEM cells. Moreover, several other human T leukemic cell lines, but not many other cell lines examined, displayed a similarly augmented NF-{kappa}B and p21cip1/waf1 responses. Mechanistic investigations revealed that this unusual NF-{kappa}B response in a select set of T leukemic cells derives from unusually low basal expression of p50 proteins. This leads to a reduced capacity of these T cells to activate the classic p50:p65 dimers and a lower p21cip1/waf1-inducing potential. When these cells are preexposed to a NF-{kappa}B-activating stimulus, such as TPA, NF-{kappa}B-dependent induction of p50 occurs with the concomitant increase in the cellular potential to activate p50:p65 heterodimer and p21cip1/waf1 gene in response to subsequent VP16 exposure. Our findings identify a previously unrecognized cellular setting in which a regulation of basal p50 expression has a profound effect on differential NF-{kappa}B dimer activation, NF-{kappa}B target gene induction, and cellular resistance to anticancer agents.


   Results
Top
 Notes
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 Acknowledgements
 References
 
Stimulation of CEM T Leukemic Cells with TPA Increases Subsequent NF-{kappa}B Activation Responsiveness
To determine the potential role of PKC in NF-{kappa}B activation by genotoxic agents in CEM T leukemic cells, we employed two different strategies: pharmacologic PKC inhibition and down-regulation of the expression of multiple PKC isoforms by a prolonged exposure to TPA. Although pretreatment of CEM cells with multiple PKC inhibitors displayed little inhibitory activity toward VP16-induced NF-{kappa}B activation (data not shown), cells pretreated with TPA for a prolonged period displayed greatly augmented, rather than reduced, VP16-dependent NF-{kappa}B activation in an electrophoretic mobility shift assay (EMSA; Fig. 1A ). This NF-{kappa}B activity was greater than the sum of activations observed in cells treated with TPA or VP16 alone (Fig. 1B). There was no augmented Oct-1 activity seen (Fig. 1A). Thus, preexposure of these T leukemic cells to TPA modulated their NF-{kappa}B responsiveness to the genotoxic agent. Below, we describe the studies focusing on the mechanism and significance of this unusual NF-{kappa}B response.


Figure 1
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 1. Stimulation of CEM T leukemic cells with TPA increases subsequent NF-{kappa}B activation responsiveness. A. CEM cells were left untreated or treated with TPA for 18 hours followed by VP16 (10 µmol/L) for 3 hours. Protein extracts (10 µg) were used for EMSA with Ig{kappa}-{kappa}B and Oct-1 site. B. Results from three experiments done as in (A) were quantified by phosphoimager. Columns, average; bars, SD. C. Parental CEM cells and CEM cells expressing S32/36A-I{kappa}B{alpha} cells were treated with TPA for 15 hours followed by a 6-hour VP16 treatment (TV). Untreated (–), TPA treatment for 21 hours (T), and exposure to VP16 for 6 hours (V) are included for comparison. RNA was purified with Qiagen RNeasy method and reverse transcribed, and cDNA levels of p21cip1/waf1 were quantified by quantitative real-time PCR. Columns, average (as calculated by Microsoft Excel) of three experiments; bars, SD. Expression of p21cip1/waf1 in untreated condition is defined as unity throughout the article. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. D. CEM cells stably expressing pSilencer-scramble (pSi-scr) or pSilencer-p21cip1/waf1 (pSi-p21) were treated with TPA for 18 hours followed by a 96-hour VP16 treatment at 0.5 µmol/L. Cells were fixed and stained with propidium iodide. Propidium iodide incorporation was analyzed by fluorescence-activated cell sorting to identify the sub-G0-G1 fraction. Columns, average of three experiments; bars, SD. *, P < 0.05, ANOVA analysis; *, P < 0.05, Tukey's test (GraphPad Prism program). E. CEM cells stably expressing pSilencer-scramble or pSilencer-p21cip1/waf1 were treated with TPA for 18 hours followed by a 6-hour VP16 treatment at 0.5 µmol/L. p21cip1/waf1 expression was then analyzed by immunoprecipitation and Western blotting using antibody specific to p21cip1/waf1 (11). Note that the induction of p21cip1/waf1 protein is much lower than that reported previously (11) due to lower VP16 dose employed. Western blotting using an anti-tubulin antibody was employed as control.

 
Augmented NF-{kappa}B Response Is Associated with Superinduction of p21cip1/waf1 and Increased Survival of CEM Cells
To gain insight into the potential significance of the above augmented NF-{kappa}B response, we examined the expression of p21cip1/waf1 that we found previously to be NF-{kappa}B inducible in CEM cells (11). The expression of p21cip1/waf1 as measured by quantitative real-time reverse transcription-PCR was induced ~35- and ~20-fold by VP16 and TPA treatment, respectively (Fig. 1C). Surprisingly, a sequential stimulation of CEM cells with TPA followed by VP16 led to ~1,800-fold induction of the p21cip1/waf1 RNA. This p21cip1/waf1 superinduction was largely NF-{kappa}B dependent, because its expression was markedly reduced in CEM cells stably expressing the superrepressor S32/36A-I{kappa}B{alpha} protein that prevents NF-{kappa}B activation (Fig. 1C). The TPA- and VP16-dependent p21cip1/waf1 induction was also inhibited by the expression of the superrepressor by 70% and 50%, respectively, based on quantitative real-time analysis. Moreover, when induction of apoptosis was measured by the percentage of cells in sub-G0-G1 DNA content using propidium iodide staining of fixed cells, stable CEM p21cip1/waf1 knockdown cells (generated and described in ref. 11; Fig. 1E) showed a significant (P < 0.05) increase in apoptosis under the p21cip1/waf1 superinduction condition (72%) when compared with that induced in CEM cells expressing the control pSilencer vector under the same condition (33%; Fig. 1D).

TPA-Induced Increase in NF-{kappa}B Activation Responsiveness Involves an Exchange of NF-{kappa}B Dimers
Because NF-{kappa}B-dependent gene regulation was profoundly modulated in above experiments, we next to sought to determine the mechanism behind this augmentation of the NF-{kappa}B activation response. We examined whether VP16 dose response or kinetics of NF-{kappa}B activation was altered when CEM cells were preexposed to TPA. Results in Fig. 2A to D showed that TPA pretreatment did not alter the time course of VP16-dependent NF-{kappa}B activation or the half-maximal VP16 dose. The lack of changes in dose response and kinetics of VP16-dependent NF-{kappa}B activation suggested that the heightened NF-{kappa}B response might not involve an increased VP16-induced signaling capacity. To test this, we measured three key signaling events (IKK activation, I{kappa}B{alpha} degradation, and p65 nuclear translocation) in CEM cells. In line with the above hypothesis, none of these events correlated with the increased NF-{kappa}B response (data not shown). We also considered the possibility that previously described post-translational modifications of p65, such as phosphorylation (45-48) and acetylation (49-54) events, contribute to the augmented DNA-binding response seen in TPA-exposed CEM cells. We employed a combination of pharmacologic inhibitors, site-directed mutagenesis, and stable reconstitution of CEM cells with different p65 mutant proteins; however, these studies yielded no positive association with the increased NF-{kappa}B DNA-binding activity seen in VP16-exposed cells after prolonged TPA treatment (data not shown).


Figure 2
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 2. TPA preexposure alters the efficacy, but not the potency or kinetics, of a subsequent NF-{kappa}B activation response in CEM cells. A. CEM cells were treated with or without TPA for a total of 21 hours. Some of the cells were also treated with VP16 at the last 1/3 to 6 hours. B. Three experiments were done as in (A) and quantified and plotted. Points, average of three experiments; bars, SD. C. CEM cells were treated with or without TPA for 18 hours followed by VP16 for 3 hours at the indicated doses. EMSA was done with the Ig{kappa}-{kappa}B probe. D. EMSA in (C) was quantified by phosphoimager analysis and the levels of NF-{kappa}B binding were plotted against VP16 doses.

 
Next, we explored the possibility that alterations in NF-{kappa}B complexes contributed to increased NF-{kappa}B DNA-binding activity. Different NF-{kappa}B dimers are known to possess differential affinities to various {kappa}B-binding elements (1). We did supershift experiments coupled with longer electrophoresis periods to enhance the detection of different NF-{kappa}B complexes in native gels. The VP16-induced NF-{kappa}B complexes in CEM cells migrated as two separable bands (denoted * and #; Fig. 3A ) as found previously in these cells (33, 40). The slower migrating one (complex *) was supershifted by both anti-p65 and anti-cRel but not by anti-p50 antibody. The faster migrating band (complex #) reacted with anti-p65 and anti-p50 antibodies. These results showed that complex * consisted of p65 and cRel, possibly a p65:cRel heterodimer, whereas complex # consisted of the classic p50:p65 heterodimer. Under conditions where these cells are preexposed to TPA, an additional fast migrating band was detected (complex $) along with p65:p50 (#). It is supershifted by both anti-cRel and anti-p50 antibodies but not by anti-p65 antibody. These results suggested that the complex $ is composed of the p50:cRel heterodimer. Neither anti-RelB nor anti-p52 could supershift these complexes (data not shown). The NF-{kappa}B complexes seen under the TPA + VP16 condition (complexes # and $) were supershifted partially by anti-p65 and anti-cRel antibodies and completely reacted with anti-p50 antibody. Thus, the augmented NF-{kappa}B DNA binding was associated with increased p50-containing complexes, p50:p65 and p50:cRel, with the concomitant reduction in the p65:cRel binding. Coimmunoprecipitation experiments using anti-p65, anti-p50, or anti-cRel antibody also indicated that there were increases in the levels of p50 associated with both p65 and cRel following prolonged TPA treatment of CEM cells (Fig. 3B). These results suggested that TPA exposure of CEM cells altered the set point of NF-{kappa}B activation potential (as measured by EMSA) by altering the relative levels of NF-{kappa}B dimeric complexes.


Figure 3
View larger version (76K):
[in this window]
[in a new window]
  		FIGURE 3. TPA-dependent increase in NF-{kappa}B responsiveness involves an exchange of NF-{kappa}B dimers. A. CEM cells were pretreated with TPA for 18 hours before the addition of VP16 for an additional 3 hours. Supershift analysis was done to determine the specific NF-{kappa}B dimers responsible for activation using the indicated antibodies. B. CEM cells were treated as in (A). Protein lysates were then used for immunoprecipitation by an anti-p65, anti-p50, or anti-cRel antibody followed by Western blot analysis to determine the levels of their associations. Input control (10%) was also analyzed for control. Note that p50 association with both p65 and cRel is increased following TPA treatment.

 
Exchange of NF-{kappa}B Dimers Requires p65- and ELF1-Dependent Induction of the NFKB1 Gene That Encodes p50 Protein
To determine whether the change of NF-{kappa}B dimeric complexes seen above is associated with TPA-dependent induction of p50, we next measured p50 protein levels and NF-{kappa}B-binding activity at different time points following TPA treatment. Induction of p50 could be evident as early as 6 hours following TPA treatment with the peak induction at ~18 to 24 hours (Fig. 4A ). The degree of p50 induction directly correlated with that of the increase in the NF-{kappa}B DNA-binding activity.


Figure 4
View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 4. TPA-dependent induction of p50 is required for heightened NF-{kappa}B and p21cip1/waf1 responses. A. CEM cells were treated with TPA for 3 to 24 hours followed by a 3-hour VP16 treatment in each case. EMSA was done to determine the DNA-binding activity, whereas Western blot was done to determine the levels of p50 and p65 proteins. B. CEM cells were transiently transfected with a siRNA Smart-pool selective to NFKB1 or control siRNA by nucleofection and then treated as in Fig. 1A. Topmost row, EMSA using Ig{kappa}-{kappa}B site; last four rows, Western blots with indicated antibodies. C. NFKB1 knockdown was done as in (B). The cells were then treated with TPA for 15 hours followed by a 6-hour VP16 treatment. Total RNA was analyzed for p21cip1/waf1 expression by quantitative real-time PCR as described in Materials and Methods.

 
To determine whether p50 expression was necessary for the increase in NF-{kappa}B DNA-binding activity, we silenced the expression of NFKB1 gene that encodes p105/p50 by means of small interfering RNA (siRNA). Transient siRNA knockdown of the NFKB1 gene expression greatly attenuated the NF-{kappa}B binding under the TPA+VP16 condition (Fig. 4B). Knockdown of NFKB1 expression also attenuated the p21cip1/waf1 superinduction by >60% (Fig. 4C). Thus, these results indicated that TPA-dependent induction of p105/p50 followed by exchange of NF-{kappa}B complexes to those containing the p50 subunit was critical for augmented NF-{kappa}B and p21cip1/waf1 responses.

Previous studies reported that the NFKB1 gene is a direct target of NF-{kappa}B (25, 26, 55). Accordingly, TPA increased not only p105/p50 protein levels but also NFKB1 mRNA levels (Fig. 5A ) and the increased p50 synthesis was blocked by expression of the S32/36A-I{kappa}B{alpha} superrepressor (Fig. 5B). Similarly, a prolonged exposure to tumor necrosis factor-{alpha} (TNF-{alpha}), another NF-{kappa}B inducer, also caused increased p50 levels and NF-{kappa}B DNA binding in response to subsequent VP16 stimulation (Fig. 5C and D). Furthermore, the augmented NF-{kappa}B DNA-binding response was also observed when the second inducer was a different DNA-damaging agent (camptothecin, doxorubicin, or ionizing radiation) or an extracellular ligand (TNF-{alpha}; Fig. 5E; others not shown). These findings suggested that the augmentation of the NF-{kappa}B response in CEM cells was a general phenomenon due to repetitive activation that was associated with the NF-{kappa}B-dependent NFKB1 transcriptional induction.


Figure 5
View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 5. NF-{kappa}B-dependent induction of NFKB1 is associated with heightened NF-{kappa}B responses irrespective of the nature of first or second NF-{kappa}B-activating stimuli. A. CEM cells were treated with TPA for 21 hours and total RNA was analyzed for NFKB1 expression by quantitative reverse transcription-PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also analyzed as control. Columns, average NFKB1/glyceraldehyde-3-phosphate dehydrogenase radios of three experiments; bars, SD. B. CEM cells and those stably expressing S32/36A-I{kappa}B{alpha} were treated (or not) with TPA for 18 hours before the addition of VP16 for an additional 3 hours. Total protein extracts were analyzed by Western blotting for levels of p50, p65, and I{kappa}B{alpha} proteins (bottom). See also the position of the exogenous I{kappa}B{alpha}. C. CEM cells were treated (or not) with TPA or TNF-{alpha} for 18 hours followed by VP16 (10 µmol/L) treatment for 3 hours. Total protein extracts were used for EMSA with Ig{kappa}-{kappa}B and Oct-1 sites. D. Binding activities quantified by a phosphoimager from three experiments as done in (C). Columns, average; bars, SD. E. CEM cells were treated (or not) with TPA for 18 hours followed by treatment with VP16 (10 µmol/L) or TNF-{alpha} (10 ng/mL) for 3 hours and analyzed as in (C).

 
Besides NF-{kappa}B, little is understood regarding other factors that also contribute to the induction of the NFKB1 gene. A previous report suggested a role for the ETS family of proteins in the NFKB1 gene regulation (27). The specific family member(s) that is involved in this regulation, however, is unknown. Supershift analysis using a NFKB1 promoter DNA that contains both NF-{kappa}B and ETS binding sites showed that anti-ELF1 antibodies supershifted this complex in vitro (Fig. 6A ). In addition, chromatin immunoprecipitation showed that ELF1 constitutively occupied the NFKB1 promoter site in CEM cells and this occupancy was also increased in response to TPA exposure (Fig. 6B). In contrast, basal p65 occupancy of the NFKB1 promoter site was not detected, but clear induction of binding was observed following TPA exposure (Fig. 6B). Transient siRNA knockdown of either p65 or ELF1 expression greatly attenuated p105 expression (Fig. 6C). Together, these findings indicated that both ELF1 and NF-{kappa}B are necessary for optimal NFKB1 expression in response to TPA treatment of CEM cells.


Figure 6
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 6. ELF1 and p65 are required for TPA-dependent NFKB1 induction. A. Untreated and TPA (21 hours)–treated CEM cells were collected, and cellular lysates were prepared for EMSA. Supershift analysis was done with anti-ELF1 and anti-ETS1 antibodies to determine ETS1 and ELF1 association with the p105-Ets element. B. Chromatin immunoprecipitation assays were done with anti-p65 and anti-ELF1 antibodies as described in Materials and Methods. Results are presented using untreated CEM sample that is precipitated by control IgG as unity. Columns, average levels of NFKB1 promoter DNA recovered in three experiments; bars, SD. C. CEM cells transfected with siRNAs specific to ELF1 or p65 were left untreated or treated with TPA for 21 hours. Control siRNA-transfected CEM cells (Scramble) were also analyzed in parallel. Western blotting was done to analyze the expression of p105, p65, ELF1, and tubulin (as loading control).

 
p21cip1/waf1 Superinduction Is Selective to a Subset of Human T Leukemic Cells
To determine whether the NF-{kappa}B and p21cip1/waf1 superinduction responses observed in CEM cells could also be found in other cell systems, we next examined NF-{kappa}B responses in various human cell lines. The cell lines included several T leukemic cell lines (MOLT-4, RPMI-8402, PF382, ALL-SIL, HPB-ALL, Karpas-45, Loucy, and MOLT-13), acute lymphoblastic leukemia lines from the B-cell lineages (Sup-B15, Reh, and RS4;11), acute myeloid leukemia cell lines (GDM1 and Kasumi3), a Burkitt's lymphoma cell line (Ramos), an erythroleukemia cell line (K562), a monocyte cell line (EL1), two prostate cancer lines (PC3 and DU145), an embryonic kidney cell line (HEK293), a cervical cancer cell line (HeLa), a lung cancer cell line (Hep2), a liver cancer cell line (HepG2), and a breast cancer cell line (MDA-MB-231). Our findings suggested that augmented NF-{kappa}B DNA-binding response (Fig. 7A-C ) and p21cip1/waf1 superinduction (Fig. 7D-F) under the TPA + VP16 condition were selectively seen in a subset of T leukemic lines. Intriguingly, and consistent with the finding in CEM cells, those T leukemic cell lines that displayed augmented NF-{kappa}B and p21cip1/waf1 responses all showed very low basal p50 expression levels (summarized in Table 1 ). These findings indicated that, among the cell lines examined, only a subgroup of human T leukemic cell lines possessed this unique augmentation of the NF-{kappa}B and p21cip1/waf1 induction potential due to the exceedingly low basal p50 expression levels.


Figure 7
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 7. TPA-dependent increase in NF-{kappa}B responsiveness occurs in a subset of T leukemic cells. RPMI-8402 (A), PF382 (B), or MOLT-4 (C) cells were treated with or without TPA or TNF-{alpha} for 18 hours followed by treatment with VP16 (10 µmol/L) for 3 hours. Total protein extracts were used for EMSA analysis with Ig{kappa}-{kappa}B (top) or Western blot analysis with anti-p50 or tubulin antibodies (bottom). RPMI-8402 (D), PF382 (E), or MOLT-4 (F) cells were untreated or treated with TPA for 15 hours followed by VP16 (10 µmol/L) for 6 hours. Total RNA was analyzed by quantitative real-time PCR for p21cip1/waf1 gene induction. Relative averages and ranges from two independent experiments for different conditions for different cell lines were plotted by setting the level of induction of p21cip1/waf1 in CEM cells untreated condition (Fig. 1C) as unity.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Summary of p50 Expression and NF-{kappa}B Responses in Different Human Cell Lines

 

   Discussion
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 Acknowledgements
 References
 
In this study, we have characterized an unusual NF-{kappa}B activation phenomenon in a subgroup of human T leukemic cells, which deviates from the classic NF-{kappa}B paradigm due to very low basal expression levels of NFKB1 gene and its encoded p50 protein. Low p50 expression results in the formation of NF-{kappa}B complexes composed primarily of p65 and cRel (likely a p65:cRel heterodimer) as the major latent NF-{kappa}B complexes in these cells. When these cells are exposed to a NF-{kappa}B activation stimulus, such as TPA, NFKB1 transcription is induced in an ELF1- and p65-dependent manner, leading to increased p50 (and its precursor p105) protein levels. Increased levels of p50 promotes a dimer exchange from the p65:cRel to the p50-containing dimers (p50:p65 and p50:cRel) as the major latent NF-{kappa}B complexes and a modified set point for the inducible NF-{kappa}B DNA-binding capacity in these stimulated cells. When these cells are subsequently exposed to another stimulus, activation of p50-containing dimers display increased DNA-binding activity to Ig{kappa}-{kappa}B site due to their inherent higher affinity to this {kappa}B site (56-59). This provides an explanation for why this augmented NF-{kappa}B response was only associated with the altered efficacy of DNA binding and not with altered VP16 activation kinetics, dose response, or increases of signaling potentials (e.g., IKK activation, I{kappa}B{alpha} degradation, and p65 nuclear translocation).

One outcome of this increased NF-{kappa}B response in T leukemic cells is heightened induction of p21cip1/waf1 and increased resistance of these cells to VP16 treatment. The repertoire of NF-{kappa}B-dependent genes that behave in this manner is probably not limited to this gene alone. In Drosophila embryos, DNA-binding affinity of Dorsal (a Drosophila NF-{kappa}B family member) was shown to be a critical determinant for segregating Dorsal target gene expression (60). However, in mammalian cells, studies have shown that there is no simple correlation between NF-{kappa}B-binding affinity to a specific {kappa}B site in vitro and induction of genes regulated by such a site in vivo. For example, {kappa}B site bending changes due to intrinsic sequence differences, despite the similar binding affinity, greatly affected the outcomes of target gene expression, such as the IFN-ß gene (61). Moreover, a recent study showed that a change of a single base pair within a {kappa}B element present in MCP-1 gene was sufficient to alter its induction property in vivo without altering the binding affinity (62). Such a complexity of NF-{kappa}B-dependent transcriptional regulation was also underscored by our observation of superinduction of the interleukin-8 gene under the TPA + VP16 condition, although there was no obvious increase of NF-{kappa}B binding to a {kappa}B site present in this gene promoter by EMSA under the TPA + VP16 condition.2

Interestingly, TPA-mediated increases in cell survival in response to chemotherapeutic agents, including several topoisomerase I/II inhibitors (e.g., camptothecin, VP16, VM-26, and 4-(9-acridinylamino) methanesulphon-m-anisidide), have been reported previously in several lymphoid cell lines analyzed in this study (e.g., CEM, MOLT-4, and RPMI-8402; refs. 63-68). These reports suggested that TPA-dependent survival is mediated through its ability to differentiate these cell lines. Additional studies implicated that NF-{kappa}B activation is a critical step in TPA-mediated differentiation (69-71). NF-{kappa}B can also regulate a wide range of target genes that alter apoptotic and proliferation responses. Our study identifies p21cip1/waf1 as a critical player that promotes the TPA-dependent T leukemic cell survival response. However, because many NF-{kappa}B-regulated genes are known to retard apoptosis, such as the Bcl-2 and inhibitors of apoptosis families of proteins, there are likely other factors that contribute to TPA-dependent survival responses in T cells. Thus, the definition of the full transcriptional and functional effects of the augmented NF-{kappa}B response due to dimer exchange in T leukemic cells in response to TPA exposure requires additional genome-wide screening approaches.

The p21cip1/waf1 expression has been widely implicated in the cell cycle regulation and some apoptotic functions. Although the p53-dependent induction of p21cip1/waf1 gene is well established (8, 72), p21cip1/waf1 gene regulation in p53-deficient cells is not fully understood. Recent studies also placed p21cip1/waf1 under the regulation of several other transcription regulators, including NF-{kappa}B, Miz-1, Bcl-6, and Myc (73-76). We also reported previously that p21cip1/waf1 induction can be induced in a NF-{kappa}B-dependent manner in p53-mutant CEM T leukemic and MDA-MB-231 breast cancer cells (11). We extended these observations by showing that p21cip1/waf1 superinduction can be observed in several human T cell lines in response to sequential NF-{kappa}B activation events. Interestingly, all the T leukemic cells that display this p21cip1/waf1 superinduction response (e.g., CEM, MOLT-4, RPMI-8402, and PF382) harbor mutant p53 proteins (77).2 Although several p53-NF-{kappa}B cross-talk studies have been reported previously (78-81), these studies mostly addressed the functional relationships between NF-{kappa}B-dependent gene activation or activation of NF-{kappa}B in response to p53 modulation. Because many human cancer cell lines that are also defective for p53 do not display low basal NFKB1 expression or augmented NF-{kappa}B DNA-binding responses under repetitive stimulation conditions (ref. 77; Table 1), the lack of p53 function does not seem to be the primary determinant for down-regulation of basal NFKB1 gene expression in the above T cell lines.

Low basal expression of p105/p50 has been observed previously in certain other cellular contexts, including normal germinal center B cells (82), germinal center–derived diffuse large B-cell lymphoma cells (83), and transgenic murine Eµ-Myc lymphoma models (84). A recent study suggested that a proto-oncoprotein Bcl-6 is the direct transcriptional repressor responsible for the low basal p105/p50 expression level in these B-cell systems (85). Bcl-6 is not expressed in T cell lines that harbor very low basal levels of p105/p50 (86).2 This observation suggests that other transcriptional repressors may negatively regulate p105/p50 expression in T leukemic cells. Aberrant expression and mutations of several transcription regulators (e.g., HOX11, HOX11L2, TAL1 + LMO1/2, LYL1 + LMO2, and MLL-ENL) have been reported to contribute to the T-cell leukemogenesis (87-89). It is possible that some of these oncoproteins is involved in repressing NFKB1 gene in T leukemic cells.

Finally, our study identifies NF-{kappa}B as a potential therapeutic target for a subset of T-cell leukemias. Based on the microarray analysis published by Ferrando et al. (87), more than one third (14 of 39) of the T-acute lymphoblastic leukemia (T-ALL) patients displayed low expression levels of the NFKB1 gene (<300 based on the published Affymetrix analysis). The leukemia cells in these patients could be predisposed for the augmented NF-{kappa}B response similar to what is described in our current study. Because inhibition of NF-{kappa}B activation and p21cip1/waf1 induction sensitized CEM cells to VP16-induced apoptosis (this study and ref. 11), a combination of NF-{kappa}B and/or p21cip1/waf1 inhibitors and chemotherapeutic agents might reduce a survival response of the leukemia cells. This approach could enhance the therapeutic success of a subset of the T-ALL patients.


   Materials and Methods
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
Acknowledgements
 References
 
Cell Culture and Chemicals
CEM, MOLT-4, Loucy, Sup-B15, Reh, RS4;11, GDM1, Kasumi3, Ramos, K562, EL1, Du145, PC3, HEK293, HeLa, Hep2, HepG2, and MDA-MB-231 were purchased from and maintained under conditions recommended by the American Type Cell Culture (Manassas, VA). Derivatives of the CEM (stably expressing S32/36A-I{kappa}B{alpha}; ref. 11) were cultured in RPMI 1640 (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (HyClone Laboratory, Inc., Logan, UT), 100 units penicillin G, and 100 µg/mL streptomycin sulfate (Mediatech) with the addition of 500 µg/mL G418 (Mediatech). CEM cells stably expressing pSilencer-scramble and CEM pSilencer-p21 (generated and described in ref. 11) were maintained under the condition described above with the addition of 1 µg/mL puromycin. RPMI-8402, PF382, ALL-SIL, HPB-ALL, Karpas-45, and MOLT-13 were obtained from and cultured under conditions recommended by the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany).

Antibodies
IgG antibodies against I{kappa}B{alpha} (C-21), actin (C-11), c-Myc (9E10), p65 (C-20), and RelB (C-19) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-cRel antibody (SA-172) was obtained from Biomol (Plymouth Meeting, PA). Anti-p52 (06-413) and anti-p50 (06-886) antibodies were obtained from Upstate Biotechnology (Charlottesville, VA). A monoclonal anti-tubulin antibody was purchased from EMD Biosciences (San Diego, CA) Horseradish peroxidase–conjugated protein A and horseradish peroxidase–conjugated anti-rabbit and anti-mouse antibodies were obtained from Amersham Pharmacia Biotech (Piscataway, NJ).

Chemicals
VP16 and TPA were purchased from Sigma-Aldrich (Atlanta, GA). Human recombinant TNF-{alpha} was purchased from EMD Biosciences.

Transient siRNA Transfection
CEM cells (5 x 107) were used for nucleofection (Amaxa Biosystems, Gaithersburg, MD) under each treatment condition. Nucleofection was done under the manufacturer's recommended condition (O-017 with solution R). Smart-pool siRNA mixtures with four sets of oligonucleotides per target gene (specific to ELF1, p65, and p50) were purchased from Dharmacon (Lafayette, CO) and resuspended at 40 µmol/L concentrations. In each nucleofection reaction, 2.5 µL (100 pmol) siRNA was used.

EMSA and IKK Kinase Assay
EMSA (and the Ig{kappa}-{kappa}B oligonucleotide probe) and IKK kinase assays were done as described previously (90). The sequence for the plus strand of the p105-ETS probe used is 5'-TCGACAGTGGGAATTTCCAGCCAGGAAGTGAGAGAGTGA-3'. The experiments were repeated at least thrice, and the results were quantified by exposing dried EMSA gels on a phosphoimager screen and analyzed by the IQMac1 program. The average and SD were calculated by the Microsoft Excel program and plotted by the KaleidaGraph software.

Immunoprecipitation and Western Blotting
Immunoprecipitation experiments were done with 107 cells. The cells were lysed in 20 µL PBS and 180 µL lysis buffer as described previously (11). Supernatants were diluted further in 300 µL lysis buffer, and 1 µg anti-p65, anti-p50, or anti-p21 antibody was added to each tube. Samples were rotated for 60 minutes at 4°C. Protein G-Sepharose beads (Amersham Pharmacia Biotech) were then added to each tube, and the samples were rotated for 90 minutes at 4°C. The precipitated protein was resolved in 10% SDS-PAGE gels (12.5% SDS-PAGE gels for p21 analysis) and analyzed by Western blotting using the appropriate antibody. Input controls were generated by taking 10 µL of the supernatant before lysis buffer dilution step. Quantified Western blot data were generated with the NIH ImageJ program. The average and SD were calculated by the Microsoft Excel program and plotted by the KaleidaGraph software.

Chromatin Immunoprecipitation Analysis
Chromatin immunoprecipitation solutions were purchased from Upstate Cell Signaling Solutions (Charlottesville, VA), and the assays were done according to the manufacturer's protocol with the minor modifications. Protein-DNA cross-linking was done by incubating 7.5 x 106 CEM cells with formaldehyde at a final concentration of 1% for 10 minutes at room temperature with gentle agitation. Glycine (0.125 mol/L) was added to quench the reaction. Cells were then collected by centrifugation at 3,000 rpm for 15 minutes and washed in PBS. The lysate was sonicated with 8 pulses of 40 seconds each at 50% to 60% of maximum power with a Heat Wave Systems W185F sonicator (Ultrasonics, Farmingdale, NY) equipped with a microtip to reduce the chromatin fragments to an average size of ~500 bp. Soluble chromatin was precleared by addition of 50 µL preimmune serum followed by 100 µL salmon sperm DNA/protein A-Sepharose slurry. An aliquot of precleared chromatin was removed (input) and used in the subsequent PCR analysis. The remainder of the chromatin was diluted with immunoprecipitation dilution buffer and incubated with or without 10 µL antibody (anti-p65 from Biomol or anti-ELF1 from Santa Cruz Biotechnology) or rabbit preimmune serum in a final volume of 600 µL for 1 hour at 4°C. Immune complexes were collected by incubation with 30 µL protein A-Sepharose overnight at 4°C. Protein A-Sepharose pellets were washed according to the manufacturer's recommendations. RNase A (0.03 mg/mL) and NaCl (0.3 mol/L) were added, and cross-links were reversed by incubation for 4 hours at 65°C. Samples were digested with proteinase K (0.24 mg/mL) for 2 hours at 45°C. DNA was purified by one extraction with phenol/chloroform and one with chloroform followed by ethanol precipitation. Purified DNA was resuspended in 30 µL water. Aliquots of 2 µL were analyzed by real-time PCR with the appropriate primer pairs. In chromatin immunoprecipitation experiments, quantitative real-time data are presented by setting the untreated serum precipitated samples as unity. The average and SD were calculated by the Microsoft Excel program and plotted by the KaleidaGraph software. NFKB1 promoter, forward GAATTCCATGGATGGCAGAAGATGATCCATAT and reverse GAATTCCTAGCTCATCAATGCTTCATCCC.

Quantitative Reverse Transcription-PCR Analysis
Total RNA from CEM cells or those stably expressing hemagglutinin-tagged S32/36A-I{kappa}B{alpha} was extracted with the Qiagen (Valencia, CA) RNeasy kit. cDNA was synthesized by annealing RNA (2 µg) with 250 ng of a 1:4 mixture of random and oligo(dT) primers by heating at 68°C for 10 minutes. After renaturation, the samples were incubated with Moloney murine leukemia virus reverse transcriptase (10 units/µL; Invitrogen, Carlsbad, CA) combined with 20 mmol/L DTT, 1 mmol/L deoxynucleotide triphosphates, and 2 units/µL RNasin (Promega, Madison, WI) at 42°C for 1 hour. The reaction mixture was heat inactivated at 95°C to 100°C for 5 minutes and diluted 1:10. Quantitative real-time reverse transcription-PCR (25 µL) contained 2 µL cDNA, 12.5 µL SYBR Green (Applied Biosystems, Warrington, United Kingdom), and the appropriate primers. Product accumulation was monitored by SYBR Green fluorescence with ABI Prism 7000 Sequence Detection Systems kindly provided by Dr. Bresnick (University of Wisconsin-Madison, Madison, WI). The relative expression levels were determined from a standard curve of serial dilutions of cDNA samples. CEM cells treated under VP16 alone condition is defined as unity in all experiments. Forward and reverse primers for real-time RT-PCR are described previously (11). The average and SD were calculated by the Microsoft Excel program and plotted by the KaleidaGraph software.

Fluorescence-Activated Cell Sorting and Cell Cycle Analysis
CEM cells and derivatives were exposed to 0.5 µmol/L VP16 for a total of 96 hours either with or without the pretreatment of TPA for 21 hours. For cell cycle analysis, cells were processed as described previously (11) and analyzed on a FACScan flow cytometer (BD PharMingen, San Jose, CA). Data were analyzed using the CellQuest (BD PharMingen) and ModFit (Verity Software House, Topsham, ME) software. The average and SD of three independent experiments were calculated by the Microsoft Excel program and plotted by the KaleidaGraph software. The statistical analysis was done by GraphPad Prism program with ANOVA analysis and Tukey's multiple comparison t test.


   Acknowledgements
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
References
 
We thank Dr. Thomas Look for providing us with microarray data, Dr. Shelly M. Wuerzberger-Davis, Dr. Shelby L. O'Connor, Stephanie Markovina and other Miyamoto laboratory members for helpful discussions and critical reading of this article, and Dr. Emery Bresnick, Dr. Jianlin Chu, and Hogune Im for the use of real-time PCR equipment and assistance in optimizing conditions for chromatin immunoprecipitation and quantitative reverse transcription-PCR analyses.


   Notes
Top
 Notes
Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Grant support: American Heart Association predoctoral fellowships 0510112Z and 0310015Z (P-Y. Chang) and NIH grants R01 CA077474 and CA081065 (S. Miyamoto).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

P-Y. Chang, unpublished observations. Back

Received 12/12/05; revised 1/13/06; accepted 1/17/06.


   References
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Verma IM, Stevenson JK, Schwarz EM, Van Antwerp D, Miyamoto S. Rel/NF-{kappa}B/I{kappa}B family: intimate tales of association and dissociation. Genes Dev 1995;9:2723–35.[Free Full Text]
  2. Baldwin AS. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-{kappa}B. J Clin Invest 2001;107:241–6.[CrossRef][Medline]
  3. Zong WX, Edelstein LC, Chen C, Bash J, Gelinas C. The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-{kappa}B that blocks TNF-{alpha}-induced apoptosis. Genes Dev 1999;13:382–7.[Abstract/Free Full Text]
  4. Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS, Jr. NF-{kappa}B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 1998;281:1680–3.[Abstract/Free Full Text]
  5. Tang G, Minemoto Y, Dibling B, et al. Inhibition of JNK activation through NF-{kappa}B target genes. Nature 2001;414:313–7.[CrossRef][Medline]
  6. Grumont RJ, Rourke IJ, Gerondakis S. Rel-dependent induction of A1 transcription is required to protect B cells from antigen receptor ligation-induced apoptosis. Genes Dev 1999;13:400–11.[Abstract/Free Full Text]
  7. Chu ZL, McKinsey TA, Liu L, Gentry JJ, Malim MH, Ballard DW. Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-{kappa}B control. Proc Natl Acad Sci U S A 1997;94:10057–62.[Abstract/Free Full Text]
  8. el-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817–25.[CrossRef][Medline]
  9. Allday MJ, Inman GJ, Crawford DH, Farrell PJ. DNA damage in human B cells can induce apoptosis, proceeding from G1-S when p53 is transactivation competent and G2-M when it is transactivation defective. EMBO J 1995;14:4994–5005.[Medline]
  10. Sheikh MS, Li XS, Chen JC, Shao ZM, Ordonez JV, Fontana JA. Mechanisms of regulation of WAF1/Cip1 gene expression in human breast carcinoma: role of p53-dependent and independent signal transduction pathways. Oncogene 1994;9:3407–15.[Medline]
  11. Wuerzberger-Davis SM, Chang PY, Berchtold C, Miyamoto S. Enhanced G2-M arrest by nuclear factor-{kappa}B-dependent p21waf1/cip1 induction. Mol Cancer Res 2005;3:345–53.[Abstract/Free Full Text]
  12. Aggarwal BB. Nuclear factor-{kappa}B: the enemy within. Cancer Cell 2004;6:203–8.[CrossRef][Medline]
  13. Karin M, Yamamoto Y, Wang QM. The IKK NF-{kappa}B system: a treasure trove for drug development. Nat Rev Drug Discov 2004;3:17–26.[CrossRef][Medline]
  14. Hayden MS, Ghosh S. Signaling to NF-{kappa}B. Genes Dev 2004;18:2195–224.[Abstract/Free Full Text]
  15. Karin M, Greten FR. NF-{kappa}B: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 2005;5:749–59.[CrossRef][Medline]
  16. Ghosh S, Gifford AM, Riviere LR, Tempst P, Nolan GP, Baltimore D. Cloning of the p50 DNA binding subunit of NF-{kappa}B: homology to rel and dorsal. Cell 1990;62:1019–29.[CrossRef][Medline]
  17. Kieran M, Blank V, Logeat F, et al. The DNA binding subunit of NF{kappa}B is identical to factor KBF1 and homologous to the rel oncogene product. Cell 1990;62:1007–18.[CrossRef][Medline]
  18. Nolan GP, Ghosh S, Liou HC, Tempst P, Baltimore D. DNA binding and I{kappa}B inhibition of the cloned p65 subunit of NF-{kappa}B, a rel-related polypeptide. Cell 1991;64:961–9.[CrossRef][Medline]
  19. Gerondakis S, Grossmann M, Nakamura Y, Pohl T, Grumont R. Genetic approaches in mice to understand Rel/NF-{kappa}B and I{kappa}B function: transgenics and knockouts. Oncogene 1999;18:6888–95.[CrossRef][Medline]
  20. Attar RM, Caamano J, Carrasco D, et al. Genetic approaches to study Rel/NF-{kappa}B/I{kappa}B function in mice. Semin Cancer Biol 1997;8:93–101.[CrossRef][Medline]
  21. Liptay S, Schmid RM, Nabel EG, Nabel GJ. Transcriptional regulation of NF-{kappa}B2: evidence for {kappa}B-mediated positive and negative autoregulation. Mol Cell Biol 1994;14:7695–703.[Abstract/Free Full Text]
  22. Grumont RJ, Richardson IB, Gaff C, Gerondakis S. rel/NF-{kappa}B nuclear complexes that bind kB sites in the murine c-rel promoter are required for constitutive crel transcription in B-cells. Cell Growth Differ 1993;4:731–43.[Abstract]
  23. Bren GD, Solan NJ, Miyoshi H, Pennington KN, Pobst LJ, Paya CV. Transcription of the RelB gene is regulated by NF-{kappa}B. Oncogene 2001;20:7722–33.[CrossRef][Medline]
  24. Lombardi L, Ciana P, Cappellini C, et al. Structural and functional characterization of the promoter regions of the NFKB2 gene. Nucleic Acids Res 1995;23:2328–36.[Abstract/Free Full Text]
  25. Paya CV, Ten RM, Bessia C, Alcami J, Hay RT, Virelizier JL. NF-{kappa}B-dependent induction of the NF-{kappa}B p50 subunit gene promoter underlies self-perpetuation of human immunodeficiency virus transcription in monocytic cells. Proc Natl Acad Sci U S A 1992;89:7826–30.[Abstract/Free Full Text]
  26. Ten RM, Paya CV, Israel N, et al. The characterization of the promoter of the gene encoding the p50 subunit of NF-{kappa}B indicates that it participates in its own regulation. EMBO J 1992;11:195–203.[Medline]
  27. Lambert PF, Ludford-Menting MJ, Deacon NJ, Kola I, Doherty RR. The nfkb1 promoter is controlled by proteins of the Ets family. Mol Biol Cell 1997;8:313–23.[Abstract]
  28. Miyamoto S, Schmitt MJ, Verma IM. Qualitative changes in the subunit composition of {kappa}B-binding complexes during murine B-cell differentiation. Proc Natl Acad Sci U S A 1994;91:5056–60.[Abstract/Free Full Text]
  29. Liou HC, Sha WC, Scott ML, Baltimore D. Sequential induction of NF{kappa}B/Rel family proteins during B-cell terminal differentiation. Mol Cell Biol 1994;14:5349–59.[Abstract/Free Full Text]
  30. Saccani S, Pantano S, Natoli G. Modulation of NF-{kappa}B activity by exchange of dimers. Mol Cell 2003;11:1563–74.[CrossRef][Medline]
  31. Dorado B, Portoles P, Ballester S. NF-{kappa}B in Th2 cells: delayed and long-lasting induction through the TCR complex. Eur J Immunol 1998;28:2234–44.[CrossRef][Medline]
  32. Banerjee D, Liou HC, Sen R. c-Rel-dependent priming of naive T cells by inflammatory cytokines. Immunity 2005;23:445–58.[CrossRef][Medline]
  33. Piret B, Piette J. Topoisomerase poisons activate the transcription factor NF-{kappa}B in ACH-2 and CEM cells. Nucleic Acids Res 1996;24:4242–8.[Abstract/Free Full Text]
  34. Lin SC, Wortis HH, Stavnezer J. The ability of CD40L, but not lipopolysaccharide, to initiate immunoglobulin switching to immunoglobulin G1 is explained by differential induction of NF-{kappa}B/Rel proteins. Mol Cell Biol 1998;18:5523–32.[Abstract/Free Full Text]
  35. Tan C, Waldmann TA. Proteasome inhibitor PS-341, a potential therapeutic agent for adult T-cell leukemia. Cancer Res 2002;62:1083–6.[Abstract/Free Full Text]
  36. Harhaj EW, Maggirwar SB, Good L, Sun SC. CD28 mediates a potent costimulatory signal for rapid degradation of I{kappa}Bß which is associated with accelerated activation of various NF-{kappa}B/Rel heterodimers. Mol Cell Biol 1996;16:6736–43.[Abstract]
  37. Maggirwar SB, Harhaj EW, Sun SC. Regulation of the interleukin-2 CD28-responsive element by NF-ATP and various NF-{kappa}B/Rel transcription factors. Mol Cell Biol 1997;17:2605–14.[Abstract]
  38. Kanno T, Brown K, Franzoso G, Siebenlist U. Kinetic analysis of human T-cell leukemia virus type I Tax-mediated activation of NF-{kappa}B. Mol Cell Biol 1994;14:6443–51.[Abstract/Free Full Text]
  39. Schafer SL, Hiscott J, Pitha PM. Differential regulation of the HIV-1 LTR by specific NF-{kappa}B subunits in HSV-1-infected cells. Virology 1996;224:214–23.[CrossRef][Medline]
  40. Huang TT, Wuerzberger-Davis SM, Seufzer BJ, et al. NF-{kappa}B activation by camptothecin. A linkage between nuclear DNA damage and cytoplasmic signaling events. J Biol Chem 2000;275:9501–9.[Abstract/Free Full Text]
  41. Krappmann D, Patke A, Heissmeyer V, Scheidereit C. B-cell receptor- and phorbol ester-induced NF-{kappa}B and c-Jun N-terminal kinase activation in B cells requires novel protein kinase C's. Mol Cell Biol 2001;21:6640–50.[Abstract/Free Full Text]
  42. Guo B, Su TT, Rawlings DJ. Protein kinase C family functions in B-cell activation. Curr Opin Immunol 2004;16:367–73.[CrossRef][Medline]
  43. Sliva D. Signaling pathways responsible for cancer cell invasion as targets for cancer therapy. Curr Cancer Drug Targets 2004;4:327–36.[CrossRef][Medline]
  44. Moscat J, Rennert P, Diaz-Meco MT. PKC{zeta} at the crossroad of NF-{kappa}B and Jak1/Stat6 signaling pathways. Cell Death Differ 2005 (epub ahead of print).
  45. Vermeulen L, De Wilde G, Van Damme P, Vanden Berghe W, Haegeman G. Transcriptional activation of the NF-{kappa}B p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J 2003;22:1313–24.[CrossRef][Medline]
  46. Zhong H, Voll RE, Ghosh S. Phosphorylation of NF-{kappa}B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1998;1:661–71.[CrossRef][Medline]
  47. Wang D, Westerheide SD, Hanson JL, Baldwin AS, Jr. Tumor necrosis factor {alpha}-induced phosphorylation of RelA/p65 on Ser529 is controlled by casein kinase II. J Biol Chem 2000;275:32592–7.[Abstract/Free Full Text]
  48. Sakurai H, Chiba H, Miyoshi H, Sugita T, Toriumi W. I{kappa}B kinases phosphorylate NF-{kappa}B p65 subunit on serine 536 in the transactivation domain. J Biol Chem 1999;274:30353–6.[Abstract/Free Full Text]
  49. Chen LF, Williams SA, Mu Y, et al. NF-{kappa}B RelA phosphorylation regulates RelA acetylation. Mol Cell Biol 2005;25:7966–75.[Abstract/Free Full Text]
  50. Chen LF, Mu Y, Greene WC. Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-{kappa}B. EMBO J 2002;21:6539–48.[CrossRef][Medline]
  51. Chen LF, Greene WC. Regulation of distinct biological activities of the NF{kappa}B transcription factor complex by acetylation. J Mol Med 2003;81:549–57.[CrossRef][Medline]
  52. Chen L, Fischle W, Verdin E, Greene WC. Duration of nuclear NF-{kappa}B action regulated by reversible acetylation. Science 2001;293:1653–7.[Abstract/Free Full Text]
  53. Greene WC, Chen LF. Regulation of NF-{kappa}B action by reversible acetylation. Novartis Found Symp 2004;259:208–17; discussion 218–25.[Medline]
  54. Kiernan R, Bres V, Ng RW, et al. Post-activation turn-off of NF-{kappa}B-dependent transcription is regulated by acetylation of p65. J Biol Chem 2003;278:2758–66.[Abstract/Free Full Text]
  55. Cogswell PC, Scheinman RI, Baldwin AS, Jr. Promoter of the human NF{kappa}B p50/p105 gene. Regulation by NF-{kappa}B subunits and by c-REL. J Immunol 1993;150:2794–804.[Abstract]
  56. Chen FE, Huang DB, Chen YQ, Ghosh G. Crystal structure of p50/p65 heterodimer of transcription factor NF-{kappa}B bound to DNA. Nature 1998;391:410–3.[CrossRef][Medline]
  57. Kunsch C, Ruben SM, Rosen CA. Selection of optimal {kappa}B/Rel DNA-binding motifs: interaction of both subunits of NF-{kappa}B with DNA is required for transcriptional activation. Mol Cell Biol 1992;12:4412–21.[Abstract/Free Full Text]
  58. Huang DB, Phelps CB, Fusco AJ, Ghosh G. Crystal structure of a free {kappa}B DNA: insights into DNA recognition by transcription factor NF-{kappa}B. J Mol Biol 2005;346:147–60.[CrossRef][Medline]
  59. Tisne C, Delepierre M, Hartmann B. How NF-{kappa}B can be attracted by its cognate DNA. J Mol Biol 1999;293:139–50.